\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0800495835:

Variant ID: vg0800495835 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 495835
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, G: 0.05, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


TTTGTAAAATAAATTTATTTGATTTTTAAGAAACTTTTATATAGAAATTTTTTTCATGAAATGTAATATTTATCGGTTTGAGAAACGTGCTAACAGGTTA[C/G]
GATGGAGTAGCTGTTTCAAAAGGATAAAACAAACTCAGCAATAGATGCTCTATCACATACGTGATTTTTTTCAAAAAGGAGAAAGTAGAAATAATACTTT

Reverse complement sequence

AAAGTATTATTTCTACTTTCTCCTTTTTGAAAAAAATCACGTATGTGATAGAGCATCTATTGCTGAGTTTGTTTTATCCTTTTGAAACAGCTACTCCATC[G/C]
TAACCTGTTAGCACGTTTCTCAAACCGATAAATATTACATTTCATGAAAAAAATTTCTATATAAAAGTTTCTTAAAAATCAAATAAATTTATTTTACAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.20% 44.80% 0.08% 0.00% NA
All Indica  2759 36.30% 63.60% 0.11% 0.00% NA
All Japonica  1512 83.50% 16.50% 0.00% 0.00% NA
Aus  269 77.00% 23.00% 0.00% 0.00% NA
Indica I  595 53.80% 46.10% 0.17% 0.00% NA
Indica II  465 11.80% 88.00% 0.22% 0.00% NA
Indica III  913 36.50% 63.50% 0.00% 0.00% NA
Indica Intermediate  786 37.30% 62.60% 0.13% 0.00% NA
Temperate Japonica  767 97.10% 2.90% 0.00% 0.00% NA
Tropical Japonica  504 61.10% 38.90% 0.00% 0.00% NA
Japonica Intermediate  241 87.10% 12.90% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 46.70% 52.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0800495835 C -> G LOC_Os08g01810.1 upstream_gene_variant ; 3499.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800495835 C -> G LOC_Os08g01830.1 upstream_gene_variant ; 1025.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800495835 C -> G LOC_Os08g01820.1 downstream_gene_variant ; 930.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800495835 C -> G LOC_Os08g01820-LOC_Os08g01830 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0800495835 NA 2.07E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800495835 NA 5.71E-08 mr1423 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800495835 NA 9.54E-06 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800495835 NA 1.61E-09 mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800495835 3.33E-06 2.45E-13 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800495835 NA 4.91E-06 mr1746 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800495835 NA 9.39E-08 mr1746 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800495835 NA 5.79E-13 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800495835 NA 3.99E-13 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800495835 NA 1.08E-07 mr1800 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800495835 NA 5.04E-06 mr1875 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800495835 NA 1.16E-06 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800495835 NA 5.45E-06 mr1041_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800495835 NA 4.17E-08 mr1137_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800495835 NA 1.70E-06 mr1617_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251