\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0800493307:

Variant ID: vg0800493307 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 493307
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.70, C: 0.31, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:


TCATCTTCACCTTCACCTTGAACTAATACCCTGTTTAGTTCGCGAAAAGAAAATTTTTGGTATCACATCGGATGTTTGACCAGATATCGGAATGGGTTTT[C/T]
GGACACGAATGAAAAAACTAATTTCATAACTCGCCTGGAAACCGCGAGACGAATCTTTTGAGCCTAATTAAGCCATCATTAGCACATGTCCGAATGTCGG

Reverse complement sequence

CCGACATTCGGACATGTGCTAATGATGGCTTAATTAGGCTCAAAAGATTCGTCTCGCGGTTTCCAGGCGAGTTATGAAATTAGTTTTTTCATTCGTGTCC[G/A]
AAAACCCATTCCGATATCTGGTCAAACATCCGATGTGATACCAAAAATTTTCTTTTCGCGAACTAAACAGGGTATTAGTTCAAGGTGAAGGTGAAGATGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.30% 45.50% 0.23% 0.00% NA
All Indica  2759 70.90% 28.80% 0.33% 0.00% NA
All Japonica  1512 14.70% 85.20% 0.07% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 60.70% 38.70% 0.67% 0.00% NA
Indica II  465 87.50% 12.50% 0.00% 0.00% NA
Indica III  913 71.70% 28.10% 0.11% 0.00% NA
Indica Intermediate  786 67.80% 31.70% 0.51% 0.00% NA
Temperate Japonica  767 2.90% 97.10% 0.00% 0.00% NA
Tropical Japonica  504 34.30% 65.50% 0.20% 0.00% NA
Japonica Intermediate  241 11.60% 88.40% 0.00% 0.00% NA
VI/Aromatic  96 71.90% 28.10% 0.00% 0.00% NA
Intermediate  90 55.60% 43.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0800493307 C -> T LOC_Os08g01810.1 upstream_gene_variant ; 971.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800493307 C -> T LOC_Os08g01820.1 upstream_gene_variant ; 376.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800493307 C -> T LOC_Os08g01830.1 upstream_gene_variant ; 3553.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800493307 C -> T LOC_Os08g01810-LOC_Os08g01820 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0800493307 NA 7.30E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800493307 NA 2.60E-06 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800493307 NA 3.72E-12 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800493307 NA 1.84E-08 mr1746 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800493307 NA 6.77E-06 mr1800 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800493307 NA 6.80E-08 mr1170_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800493307 1.94E-06 1.68E-14 mr1277_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800493307 NA 3.86E-06 mr1553_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800493307 NA 9.76E-07 mr1558_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800493307 3.86E-07 NA mr1746_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800493307 9.80E-07 2.37E-13 mr1746_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800493307 NA 1.69E-08 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251