Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0800493307:

Variant ID: vg0800493307 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 493307
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.70, C: 0.31, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:

TCATCTTCACCTTCACCTTGAACTAATACCCTGTTTAGTTCGCGAAAAGAAAATTTTTGGTATCACATCGGATGTTTGACCAGATATCGGAATGGGTTTT[C/T]
GGACACGAATGAAAAAACTAATTTCATAACTCGCCTGGAAACCGCGAGACGAATCTTTTGAGCCTAATTAAGCCATCATTAGCACATGTCCGAATGTCGG

Reverse complement sequence

CCGACATTCGGACATGTGCTAATGATGGCTTAATTAGGCTCAAAAGATTCGTCTCGCGGTTTCCAGGCGAGTTATGAAATTAGTTTTTTCATTCGTGTCC[G/A]
AAAACCCATTCCGATATCTGGTCAAACATCCGATGTGATACCAAAAATTTTCTTTTCGCGAACTAAACAGGGTATTAGTTCAAGGTGAAGGTGAAGATGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.30%	45.50%	0.23%	0.00%	NA
All Indica	2759	70.90%	28.80%	0.33%	0.00%	NA
All Japonica	1512	14.70%	85.20%	0.07%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	60.70%	38.70%	0.67%	0.00%	NA
Indica II	465	87.50%	12.50%	0.00%	0.00%	NA
Indica III	913	71.70%	28.10%	0.11%	0.00%	NA
Indica Intermediate	786	67.80%	31.70%	0.51%	0.00%	NA
Temperate Japonica	767	2.90%	97.10%	0.00%	0.00%	NA
Tropical Japonica	504	34.30%	65.50%	0.20%	0.00%	NA
Japonica Intermediate	241	11.60%	88.40%	0.00%	0.00%	NA
VI/Aromatic	96	71.90%	28.10%	0.00%	0.00%	NA
Intermediate	90	55.60%	43.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0800493307	C -> T	LOC_Os08g01810.1	upstream_gene_variant ; 971.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800493307	C -> T	LOC_Os08g01820.1	upstream_gene_variant ; 376.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800493307	C -> T	LOC_Os08g01830.1	upstream_gene_variant ; 3553.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800493307	C -> T	LOC_Os08g01810-LOC_Os08g01820	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0800493307	NA	7.30E-06	mr1364	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800493307	NA	2.60E-06	mr1443	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800493307	NA	3.72E-12	mr1746	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800493307	NA	1.84E-08	mr1746	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800493307	NA	6.77E-06	mr1800	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800493307	NA	6.80E-08	mr1170_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800493307	1.94E-06	1.68E-14	mr1277_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800493307	NA	3.86E-06	mr1553_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800493307	NA	9.76E-07	mr1558_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800493307	3.86E-07	NA	mr1746_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800493307	9.80E-07	2.37E-13	mr1746_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800493307	NA	1.69E-08	mr1805_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251