Variant ID: vg0800493307 (JBrowse) | Variation Type: SNP |
Chromosome: chr08 | Position: 493307 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.70, C: 0.31, others allele: 0.00, population size: 204. )
TCATCTTCACCTTCACCTTGAACTAATACCCTGTTTAGTTCGCGAAAAGAAAATTTTTGGTATCACATCGGATGTTTGACCAGATATCGGAATGGGTTTT[C/T]
GGACACGAATGAAAAAACTAATTTCATAACTCGCCTGGAAACCGCGAGACGAATCTTTTGAGCCTAATTAAGCCATCATTAGCACATGTCCGAATGTCGG
CCGACATTCGGACATGTGCTAATGATGGCTTAATTAGGCTCAAAAGATTCGTCTCGCGGTTTCCAGGCGAGTTATGAAATTAGTTTTTTCATTCGTGTCC[G/A]
AAAACCCATTCCGATATCTGGTCAAACATCCGATGTGATACCAAAAATTTTCTTTTCGCGAACTAAACAGGGTATTAGTTCAAGGTGAAGGTGAAGATGA
Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 54.30% | 45.50% | 0.23% | 0.00% | NA |
All Indica | 2759 | 70.90% | 28.80% | 0.33% | 0.00% | NA |
All Japonica | 1512 | 14.70% | 85.20% | 0.07% | 0.00% | NA |
Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
Indica I | 595 | 60.70% | 38.70% | 0.67% | 0.00% | NA |
Indica II | 465 | 87.50% | 12.50% | 0.00% | 0.00% | NA |
Indica III | 913 | 71.70% | 28.10% | 0.11% | 0.00% | NA |
Indica Intermediate | 786 | 67.80% | 31.70% | 0.51% | 0.00% | NA |
Temperate Japonica | 767 | 2.90% | 97.10% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 34.30% | 65.50% | 0.20% | 0.00% | NA |
Japonica Intermediate | 241 | 11.60% | 88.40% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 71.90% | 28.10% | 0.00% | 0.00% | NA |
Intermediate | 90 | 55.60% | 43.30% | 1.11% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0800493307 | C -> T | LOC_Os08g01810.1 | upstream_gene_variant ; 971.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
vg0800493307 | C -> T | LOC_Os08g01820.1 | upstream_gene_variant ; 376.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
vg0800493307 | C -> T | LOC_Os08g01830.1 | upstream_gene_variant ; 3553.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
vg0800493307 | C -> T | LOC_Os08g01810-LOC_Os08g01820 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0800493307 | NA | 7.30E-06 | mr1364 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0800493307 | NA | 2.60E-06 | mr1443 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0800493307 | NA | 3.72E-12 | mr1746 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0800493307 | NA | 1.84E-08 | mr1746 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0800493307 | NA | 6.77E-06 | mr1800 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0800493307 | NA | 6.80E-08 | mr1170_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0800493307 | 1.94E-06 | 1.68E-14 | mr1277_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0800493307 | NA | 3.86E-06 | mr1553_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0800493307 | NA | 9.76E-07 | mr1558_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0800493307 | 3.86E-07 | NA | mr1746_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0800493307 | 9.80E-07 | 2.37E-13 | mr1746_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0800493307 | NA | 1.69E-08 | mr1805_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |