Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0800452763:

Variant ID: vg0800452763 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 452763
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

TGCAAAACAGATAACTCATTCTATTTAGAGCTTTACGTACTCCCTTGATCATTCCAAGAATGCGTTTGCTTCAAAATGCCTGGGAACTGGGAATTTATCT[G/A]
TAGAGTCATTCTAGTTATAATGTGGATACCAGATACCGAATACCTACTTATTTACCAGAGTATATTGCATTCGAAATGAAGCGCTTGGAGCTTTATCCGC

Reverse complement sequence

GCGGATAAAGCTCCAAGCGCTTCATTTCGAATGCAATATACTCTGGTAAATAAGTAGGTATTCGGTATCTGGTATCCACATTATAACTAGAATGACTCTA[C/T]
AGATAAATTCCCAGTTCCCAGGCATTTTGAAGCAAACGCATTCTTGGAATGATCAAGGGAGTACGTAAAGCTCTAAATAGAATGAGTTATCTGTTTTGCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.40%	45.50%	0.13%	0.00%	NA
All Indica	2759	27.00%	72.80%	0.22%	0.00%	NA
All Japonica	1512	98.50%	1.50%	0.00%	0.00%	NA
Aus	269	92.60%	7.40%	0.00%	0.00%	NA
Indica I	595	43.00%	56.60%	0.34%	0.00%	NA
Indica II	465	9.50%	90.30%	0.22%	0.00%	NA
Indica III	913	19.80%	80.20%	0.00%	0.00%	NA
Indica Intermediate	786	33.50%	66.20%	0.38%	0.00%	NA
Temperate Japonica	767	98.60%	1.40%	0.00%	0.00%	NA
Tropical Japonica	504	99.00%	1.00%	0.00%	0.00%	NA
Japonica Intermediate	241	97.50%	2.50%	0.00%	0.00%	NA
VI/Aromatic	96	29.20%	70.80%	0.00%	0.00%	NA
Intermediate	90	65.60%	34.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0800452763	G -> A	LOC_Os08g01740.1	downstream_gene_variant ; 2374.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800452763	G -> A	LOC_Os08g01740.2	downstream_gene_variant ; 2374.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800452763	G -> A	LOC_Os08g01750.1	intron_variant ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800452763	G -> A	LOC_Os08g01750.3	intron_variant ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800452763	G -> A	LOC_Os08g01750.2	intron_variant ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0800452763	NA	8.67E-06	mr1030	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800452763	8.43E-09	1.80E-20	mr1746	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800452763	1.71E-08	2.46E-12	mr1746	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800452763	NA	6.65E-06	mr1876	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800452763	6.91E-10	NA	mr1277_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800452763	6.84E-09	2.00E-08	mr1277_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800452763	4.31E-10	1.10E-25	mr1746_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800452763	5.05E-08	2.73E-11	mr1746_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251