\
| Variant ID: vg0800452763 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 452763 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 236. )
TGCAAAACAGATAACTCATTCTATTTAGAGCTTTACGTACTCCCTTGATCATTCCAAGAATGCGTTTGCTTCAAAATGCCTGGGAACTGGGAATTTATCT[G/A]
TAGAGTCATTCTAGTTATAATGTGGATACCAGATACCGAATACCTACTTATTTACCAGAGTATATTGCATTCGAAATGAAGCGCTTGGAGCTTTATCCGC
GCGGATAAAGCTCCAAGCGCTTCATTTCGAATGCAATATACTCTGGTAAATAAGTAGGTATTCGGTATCTGGTATCCACATTATAACTAGAATGACTCTA[C/T]
AGATAAATTCCCAGTTCCCAGGCATTTTGAAGCAAACGCATTCTTGGAATGATCAAGGGAGTACGTAAAGCTCTAAATAGAATGAGTTATCTGTTTTGCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.40% | 45.50% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 27.00% | 72.80% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 92.60% | 7.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 43.00% | 56.60% | 0.34% | 0.00% | NA |
| Indica II | 465 | 9.50% | 90.30% | 0.22% | 0.00% | NA |
| Indica III | 913 | 19.80% | 80.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 33.50% | 66.20% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 29.20% | 70.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 65.60% | 34.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0800452763 | G -> A | LOC_Os08g01740.1 | downstream_gene_variant ; 2374.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800452763 | G -> A | LOC_Os08g01740.2 | downstream_gene_variant ; 2374.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800452763 | G -> A | LOC_Os08g01750.1 | intron_variant ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800452763 | G -> A | LOC_Os08g01750.3 | intron_variant ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800452763 | G -> A | LOC_Os08g01750.2 | intron_variant ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0800452763 | NA | 8.67E-06 | mr1030 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800452763 | 8.43E-09 | 1.80E-20 | mr1746 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800452763 | 1.71E-08 | 2.46E-12 | mr1746 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800452763 | NA | 6.65E-06 | mr1876 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800452763 | 6.91E-10 | NA | mr1277_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800452763 | 6.84E-09 | 2.00E-08 | mr1277_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800452763 | 4.31E-10 | 1.10E-25 | mr1746_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800452763 | 5.05E-08 | 2.73E-11 | mr1746_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |