\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0800438764:

Variant ID: vg0800438764 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 438764
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.68, T: 0.31, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:


CACATCATCGATGCATATTAATTGCCAGGTCTTGATTGGATGGCCTTCAAACATCGCATGTATCCAGTTTGTTGTTGGCAAAAAAAACCAACAGAAGAAT[T/A]
TTTTTTCGTTCTCTCTTAGCAGCCAACAGACGAAAGCAGCCCACTTGATAAACACGTACTCCACAATTTTTTGGTTGGAAAAAAACACGCAACCATTGAG

Reverse complement sequence

CTCAATGGTTGCGTGTTTTTTTCCAACCAAAAAATTGTGGAGTACGTGTTTATCAAGTGGGCTGCTTTCGTCTGTTGGCTGCTAAGAGAGAACGAAAAAA[A/T]
ATTCTTCTGTTGGTTTTTTTTGCCAACAACAAACTGGATACATGCGATGTTTGAAGGCCATCCAATCAAGACCTGGCAATTAATATGCATCGATGATGTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.70% 22.20% 0.08% 0.00% NA
All Indica  2759 72.70% 27.10% 0.14% 0.00% NA
All Japonica  1512 98.30% 1.70% 0.00% 0.00% NA
Aus  269 7.80% 92.20% 0.00% 0.00% NA
Indica I  595 63.00% 36.60% 0.34% 0.00% NA
Indica II  465 78.30% 21.70% 0.00% 0.00% NA
Indica III  913 80.00% 20.00% 0.00% 0.00% NA
Indica Intermediate  786 68.40% 31.30% 0.25% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 95.20% 4.80% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 74.40% 25.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0800438764 T -> A LOC_Os08g01710.1 upstream_gene_variant ; 1730.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800438764 T -> A LOC_Os08g01720.1 upstream_gene_variant ; 714.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800438764 T -> A LOC_Os08g01710-LOC_Os08g01720 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0800438764 NA 1.73E-06 mr1148 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800438764 NA 7.58E-07 mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800438764 NA 4.39E-07 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800438764 NA 2.29E-06 mr1397 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800438764 NA 5.02E-08 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800438764 NA 1.55E-06 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800438764 6.90E-06 NA mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800438764 3.35E-07 4.66E-10 mr1746 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800438764 NA 4.09E-07 mr1277_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800438764 8.64E-08 NA mr1746_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800438764 1.24E-08 8.53E-13 mr1746_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251