\
| Variant ID: vg0800438764 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 438764 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.68, T: 0.31, others allele: 0.00, population size: 186. )
CACATCATCGATGCATATTAATTGCCAGGTCTTGATTGGATGGCCTTCAAACATCGCATGTATCCAGTTTGTTGTTGGCAAAAAAAACCAACAGAAGAAT[T/A]
TTTTTTCGTTCTCTCTTAGCAGCCAACAGACGAAAGCAGCCCACTTGATAAACACGTACTCCACAATTTTTTGGTTGGAAAAAAACACGCAACCATTGAG
CTCAATGGTTGCGTGTTTTTTTCCAACCAAAAAATTGTGGAGTACGTGTTTATCAAGTGGGCTGCTTTCGTCTGTTGGCTGCTAAGAGAGAACGAAAAAA[A/T]
ATTCTTCTGTTGGTTTTTTTTGCCAACAACAAACTGGATACATGCGATGTTTGAAGGCCATCCAATCAAGACCTGGCAATTAATATGCATCGATGATGTG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 77.70% | 22.20% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 72.70% | 27.10% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 7.80% | 92.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 63.00% | 36.60% | 0.34% | 0.00% | NA |
| Indica II | 465 | 78.30% | 21.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 80.00% | 20.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 68.40% | 31.30% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 95.20% | 4.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 74.40% | 25.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0800438764 | T -> A | LOC_Os08g01710.1 | upstream_gene_variant ; 1730.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800438764 | T -> A | LOC_Os08g01720.1 | upstream_gene_variant ; 714.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800438764 | T -> A | LOC_Os08g01710-LOC_Os08g01720 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0800438764 | NA | 1.73E-06 | mr1148 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800438764 | NA | 7.58E-07 | mr1207 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800438764 | NA | 4.39E-07 | mr1369 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800438764 | NA | 2.29E-06 | mr1397 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800438764 | NA | 5.02E-08 | mr1453 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800438764 | NA | 1.55E-06 | mr1652 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800438764 | 6.90E-06 | NA | mr1746 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800438764 | 3.35E-07 | 4.66E-10 | mr1746 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800438764 | NA | 4.09E-07 | mr1277_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800438764 | 8.64E-08 | NA | mr1746_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800438764 | 1.24E-08 | 8.53E-13 | mr1746_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |