Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0800438764:

Variant ID: vg0800438764 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 438764
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.68, T: 0.31, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:

CACATCATCGATGCATATTAATTGCCAGGTCTTGATTGGATGGCCTTCAAACATCGCATGTATCCAGTTTGTTGTTGGCAAAAAAAACCAACAGAAGAAT[T/A]
TTTTTTCGTTCTCTCTTAGCAGCCAACAGACGAAAGCAGCCCACTTGATAAACACGTACTCCACAATTTTTTGGTTGGAAAAAAACACGCAACCATTGAG

Reverse complement sequence

CTCAATGGTTGCGTGTTTTTTTCCAACCAAAAAATTGTGGAGTACGTGTTTATCAAGTGGGCTGCTTTCGTCTGTTGGCTGCTAAGAGAGAACGAAAAAA[A/T]
ATTCTTCTGTTGGTTTTTTTTGCCAACAACAAACTGGATACATGCGATGTTTGAAGGCCATCCAATCAAGACCTGGCAATTAATATGCATCGATGATGTG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.70%	22.20%	0.08%	0.00%	NA
All Indica	2759	72.70%	27.10%	0.14%	0.00%	NA
All Japonica	1512	98.30%	1.70%	0.00%	0.00%	NA
Aus	269	7.80%	92.20%	0.00%	0.00%	NA
Indica I	595	63.00%	36.60%	0.34%	0.00%	NA
Indica II	465	78.30%	21.70%	0.00%	0.00%	NA
Indica III	913	80.00%	20.00%	0.00%	0.00%	NA
Indica Intermediate	786	68.40%	31.30%	0.25%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	95.20%	4.80%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	94.80%	5.20%	0.00%	0.00%	NA
Intermediate	90	74.40%	25.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0800438764	T -> A	LOC_Os08g01710.1	upstream_gene_variant ; 1730.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800438764	T -> A	LOC_Os08g01720.1	upstream_gene_variant ; 714.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800438764	T -> A	LOC_Os08g01710-LOC_Os08g01720	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0800438764	NA	1.73E-06	mr1148	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800438764	NA	7.58E-07	mr1207	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800438764	NA	4.39E-07	mr1369	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800438764	NA	2.29E-06	mr1397	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800438764	NA	5.02E-08	mr1453	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800438764	NA	1.55E-06	mr1652	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800438764	6.90E-06	NA	mr1746	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800438764	3.35E-07	4.66E-10	mr1746	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800438764	NA	4.09E-07	mr1277_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800438764	8.64E-08	NA	mr1746_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800438764	1.24E-08	8.53E-13	mr1746_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251