\
| Variant ID: vg0800430481 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 430481 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.78, A: 0.22, others allele: 0.00, population size: 182. )
ATGTATACCATTTCTTTTGGTTTTAAATAAAGCATTCGAGTAATTATCGATGGTCGGGGCTTCTGTGACTGAGAGGGAGTAAAGTAGCTTAGATATTTTA[G/A]
CGAGTGAATATATACTCCGTAAATTACCTCTGTCCCATAAAAAGTAAACCTAATTAATATGTAATGTGACACGTTCTACTACTATGTATGAATCTATGTA
TACATAGATTCATACATAGTAGTAGAACGTGTCACATTACATATTAATTAGGTTTACTTTTTATGGGACAGAGGTAATTTACGGAGTATATATTCACTCG[C/T]
TAAAATATCTAAGCTACTTTACTCCCTCTCAGTCACAGAAGCCCCGACCATCGATAATTACTCGAATGCTTTATTTAAAACCAAAAGAAATGGTATACAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.80% | 46.00% | 0.23% | 0.00% | NA |
| All Indica | 2759 | 77.60% | 22.10% | 0.36% | 0.00% | NA |
| All Japonica | 1512 | 1.50% | 98.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 55.30% | 43.70% | 1.01% | 0.00% | NA |
| Indica II | 465 | 94.60% | 5.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 83.80% | 16.00% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 77.10% | 22.60% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 1.60% | 98.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.50% | 97.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 74.00% | 26.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 46.70% | 52.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0800430481 | G -> A | LOC_Os08g01710.1 | downstream_gene_variant ; 4751.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800430481 | G -> A | LOC_Os08g01700-LOC_Os08g01710 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0800430481 | NA | 1.76E-06 | mr1060 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800430481 | NA | 5.47E-06 | mr1148 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800430481 | NA | 8.43E-17 | mr1170 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800430481 | NA | 9.87E-06 | mr1170 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800430481 | NA | 6.55E-10 | mr1277 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800430481 | NA | 4.11E-06 | mr1629 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800430481 | NA | 2.00E-09 | mr1663 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800430481 | 1.25E-09 | 6.24E-15 | mr1746 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800430481 | 4.89E-08 | 1.52E-10 | mr1746 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800430481 | NA | 1.69E-06 | mr1928 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800430481 | NA | 2.95E-11 | mr1170_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800430481 | 4.67E-07 | 1.23E-15 | mr1277_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800430481 | 1.50E-06 | NA | mr1277_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800430481 | NA | 5.91E-07 | mr1369_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800430481 | NA | 5.02E-07 | mr1453_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800430481 | NA | 4.42E-08 | mr1659_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800430481 | NA | 2.71E-08 | mr1683_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800430481 | NA | 4.33E-17 | mr1715_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800430481 | 1.98E-09 | 1.65E-19 | mr1746_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800430481 | 3.64E-08 | 3.94E-08 | mr1746_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |