\
| Variant ID: vg0800426468 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 426468 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, A: 0.00, others allele: 0.00, population size: 281. )
ATGTCCATACCTAGATGGACAGAATAAAATTTGTATCCACATTGTGATTGTACATGTTACACCCAAACCCAAATGTGTGGTATATTCCTTTTTTTTCTAT[C/A]
TTTTTGTTGAGTAGTATGTATTGATTTTTTTTTTTAAAAAAAAAGCGGCCGCGTTGCATTGCAAGTTGGAATCTAGGAAACAATTCCAATCAAGTTAAGG
CCTTAACTTGATTGGAATTGTTTCCTAGATTCCAACTTGCAATGCAACGCGGCCGCTTTTTTTTTAAAAAAAAAAATCAATACATACTACTCAACAAAAA[G/T]
ATAGAAAAAAAAGGAATATACCACACATTTGGGTTTGGGTGTAACATGTACAATCACAATGTGGATACAAATTTTATTCTGTCCATCTAGGTATGGACAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.70% | 10.00% | 0.30% | 0.00% | NA |
| All Indica | 2759 | 82.70% | 16.80% | 0.51% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 62.20% | 35.80% | 2.02% | 0.00% | NA |
| Indica II | 465 | 96.80% | 3.00% | 0.22% | 0.00% | NA |
| Indica III | 913 | 86.90% | 13.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 85.00% | 14.90% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0800426468 | C -> A | LOC_Os08g01700-LOC_Os08g01710 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0800426468 | NA | 1.12E-06 | mr1148 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800426468 | 5.06E-06 | NA | mr1746 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800426468 | 3.26E-06 | 8.91E-08 | mr1746 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800426468 | NA | 4.32E-06 | mr1881 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800426468 | NA | 3.24E-06 | mr1928 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800426468 | NA | 3.64E-07 | mr1928 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800426468 | 7.01E-06 | NA | mr1746_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800426468 | 8.01E-07 | 1.80E-07 | mr1746_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |