Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0800421304:

Variant ID: vg0800421304 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 421304
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.75, A: 0.24, others allele: 0.00, population size: 159. )

Flanking Sequence (100 bp) in Reference Genome:

ACATCACATTTTTTTATGTAGCATAATAGTTTTATTTTTGAATTAATTAATGAAAAATTACTATCATGTGATATTGAAAGCTTTTATCCTTTGCTTAATT[G/A]
TCTCTACTACTATAAAGGGAAGTCGTCTTTCTTCTCTTCTTCCACCATCATACACCCCATAAAAAGGAAAACCACCCTACCTAAAAAAAGACCTACTAAA

Reverse complement sequence

TTTAGTAGGTCTTTTTTTAGGTAGGGTGGTTTTCCTTTTTATGGGGTGTATGATGGTGGAAGAAGAGAAGAAAGACGACTTCCCTTTATAGTAGTAGAGA[C/T]
AATTAAGCAAAGGATAAAAGCTTTCAATATCACATGATAGTAATTTTTCATTAATTAATTCAAAAATAAAACTATTATGCTACATAAAAAAATGTGATGT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.90%	44.00%	0.06%	0.00%	NA
All Indica	2759	89.90%	10.10%	0.07%	0.00%	NA
All Japonica	1512	1.80%	98.20%	0.00%	0.00%	NA
Aus	269	7.10%	92.90%	0.00%	0.00%	NA
Indica I	595	94.10%	5.50%	0.34%	0.00%	NA
Indica II	465	92.30%	7.70%	0.00%	0.00%	NA
Indica III	913	90.10%	9.90%	0.00%	0.00%	NA
Indica Intermediate	786	84.90%	15.10%	0.00%	0.00%	NA
Temperate Japonica	767	1.70%	98.30%	0.00%	0.00%	NA
Tropical Japonica	504	1.40%	98.60%	0.00%	0.00%	NA
Japonica Intermediate	241	2.90%	97.10%	0.00%	0.00%	NA
VI/Aromatic	96	85.40%	14.60%	0.00%	0.00%	NA
Intermediate	90	38.90%	60.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0800421304	G -> A	LOC_Os08g01700.1	upstream_gene_variant ; 726.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800421304	G -> A	LOC_Os08g01700-LOC_Os08g01710	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0800421304	NA	2.16E-34	mr1129	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800421304	NA	6.93E-20	mr1253	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800421304	NA	4.26E-19	mr1255	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800421304	NA	2.69E-32	mr1257	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800421304	NA	3.99E-31	mr1745	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800421304	NA	4.00E-12	mr1746	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800421304	NA	3.19E-29	mr1793	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800421304	NA	1.23E-36	mr1828	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800421304	NA	5.49E-15	mr1870	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800421304	NA	1.10E-19	mr1913	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800421304	NA	1.04E-07	mr1946	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800421304	NA	8.88E-36	mr1129_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800421304	NA	7.93E-21	mr1253_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800421304	NA	1.42E-33	mr1257_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800421304	NA	2.16E-15	mr1578_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800421304	NA	2.58E-39	mr1745_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800421304	1.21E-07	2.53E-21	mr1746_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800421304	NA	1.43E-44	mr1793_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800421304	NA	8.11E-37	mr1913_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251