Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0800349379:

Variant ID: vg0800349379 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 349379
Reference Allele: C	Alternative Allele: G
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, G: 0.04, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:

TTTCTTTATTTGATAGAAAATTAAATGTTAAAATGGACATTTAAATATTATTTTACATGCACGAATGACGTGGCATGTACACGTGGCGTTTTAAGTGGGT[C/G]
TAAGAACTATATTAAGCCGCATGATAATCTTTAGGGTCTTTGTTTGGACATTATAAAACATCAAGGACTAATTCAACCCCTGAGCAAAAGTTGAAGGACT

Reverse complement sequence

AGTCCTTCAACTTTTGCTCAGGGGTTGAATTAGTCCTTGATGTTTTATAATGTCCAAACAAAGACCCTAAAGATTATCATGCGGCTTAATATAGTTCTTA[G/C]
ACCCACTTAAAACGCCACGTGTACATGCCACGTCATTCGTGCATGTAAAATAATATTTAAATGTCCATTTTAACATTTAATTTTCTATCAAATAAAGAAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.70%	47.20%	0.11%	0.00%	NA
All Indica	2759	71.00%	28.80%	0.18%	0.00%	NA
All Japonica	1512	13.00%	87.00%	0.00%	0.00%	NA
Aus	269	76.60%	23.40%	0.00%	0.00%	NA
Indica I	595	43.70%	56.10%	0.17%	0.00%	NA
Indica II	465	94.40%	5.60%	0.00%	0.00%	NA
Indica III	913	74.40%	25.40%	0.22%	0.00%	NA
Indica Intermediate	786	74.00%	25.70%	0.25%	0.00%	NA
Temperate Japonica	767	2.70%	97.30%	0.00%	0.00%	NA
Tropical Japonica	504	29.40%	70.60%	0.00%	0.00%	NA
Japonica Intermediate	241	11.60%	88.40%	0.00%	0.00%	NA
VI/Aromatic	96	85.40%	14.60%	0.00%	0.00%	NA
Intermediate	90	51.10%	48.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0800349379	C -> G	LOC_Os08g01580.1	downstream_gene_variant ; 2646.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800349379	C -> G	LOC_Os08g01590.1	downstream_gene_variant ; 2707.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800349379	C -> G	LOC_Os08g01590.2	downstream_gene_variant ; 2707.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800349379	C -> G	LOC_Os08g01580-LOC_Os08g01590	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0800349379	9.66E-16	2.91E-29	mr1746	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800349379	3.69E-10	4.02E-12	mr1746	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800349379	NA	1.16E-13	mr1746	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800349379	NA	7.62E-13	mr1769	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800349379	NA	3.59E-12	mr1055_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800349379	NA	7.84E-06	mr1153_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800349379	1.32E-08	2.39E-14	mr1277_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800349379	6.32E-07	NA	mr1277_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800349379	2.62E-06	NA	mr1298_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800349379	NA	5.21E-12	mr1659_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800349379	NA	1.94E-07	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800349379	7.69E-06	NA	mr1731_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800349379	5.77E-17	2.66E-36	mr1746_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800349379	8.58E-12	3.14E-14	mr1746_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800349379	3.20E-06	1.25E-11	mr1746_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800349379	NA	2.96E-13	mr1769_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800349379	NA	3.60E-08	mr1921_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251