\
| Variant ID: vg0800349379 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 349379 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, G: 0.04, others allele: 0.00, population size: 111. )
TTTCTTTATTTGATAGAAAATTAAATGTTAAAATGGACATTTAAATATTATTTTACATGCACGAATGACGTGGCATGTACACGTGGCGTTTTAAGTGGGT[C/G]
TAAGAACTATATTAAGCCGCATGATAATCTTTAGGGTCTTTGTTTGGACATTATAAAACATCAAGGACTAATTCAACCCCTGAGCAAAAGTTGAAGGACT
AGTCCTTCAACTTTTGCTCAGGGGTTGAATTAGTCCTTGATGTTTTATAATGTCCAAACAAAGACCCTAAAGATTATCATGCGGCTTAATATAGTTCTTA[G/C]
ACCCACTTAAAACGCCACGTGTACATGCCACGTCATTCGTGCATGTAAAATAATATTTAAATGTCCATTTTAACATTTAATTTTCTATCAAATAAAGAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.70% | 47.20% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 71.00% | 28.80% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 13.00% | 87.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 76.60% | 23.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 43.70% | 56.10% | 0.17% | 0.00% | NA |
| Indica II | 465 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 74.40% | 25.40% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 74.00% | 25.70% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 2.70% | 97.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 29.40% | 70.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 11.60% | 88.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 85.40% | 14.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 51.10% | 48.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0800349379 | C -> G | LOC_Os08g01580.1 | downstream_gene_variant ; 2646.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800349379 | C -> G | LOC_Os08g01590.1 | downstream_gene_variant ; 2707.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800349379 | C -> G | LOC_Os08g01590.2 | downstream_gene_variant ; 2707.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800349379 | C -> G | LOC_Os08g01580-LOC_Os08g01590 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0800349379 | 9.66E-16 | 2.91E-29 | mr1746 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800349379 | 3.69E-10 | 4.02E-12 | mr1746 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800349379 | NA | 1.16E-13 | mr1746 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800349379 | NA | 7.62E-13 | mr1769 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800349379 | NA | 3.59E-12 | mr1055_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800349379 | NA | 7.84E-06 | mr1153_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800349379 | 1.32E-08 | 2.39E-14 | mr1277_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800349379 | 6.32E-07 | NA | mr1277_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800349379 | 2.62E-06 | NA | mr1298_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800349379 | NA | 5.21E-12 | mr1659_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800349379 | NA | 1.94E-07 | mr1676_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800349379 | 7.69E-06 | NA | mr1731_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800349379 | 5.77E-17 | 2.66E-36 | mr1746_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800349379 | 8.58E-12 | 3.14E-14 | mr1746_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800349379 | 3.20E-06 | 1.25E-11 | mr1746_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800349379 | NA | 2.96E-13 | mr1769_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800349379 | NA | 3.60E-08 | mr1921_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |