\
| Variant ID: vg0800347061 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 347061 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.07, others allele: 0.00, population size: 241. )
ACAAAGACAGGGCAAGGGTTTCCATTAATCACACTCTCGAAAAATCCTTGCTTCCTTCCAAATGATGATTTCCTCCCTTATATCATTATACACCCGTGCC[A/G]
CTGAGTACGAACGTTGTTCGAAGATCCTTGCATTACGCTCTTTCTAGATGAACCAGCAAACCATCATAAAAAGGGAGTCTATATATACTATAATAATGCA
TGCATTATTATAGTATATATAGACTCCCTTTTTATGATGGTTTGCTGGTTCATCTAGAAAGAGCGTAATGCAAGGATCTTCGAACAACGTTCGTACTCAG[T/C]
GGCACGGGTGTATAATGATATAAGGGAGGAAATCATCATTTGGAAGGAAGCAAGGATTTTTCGAGAGTGTGATTAATGGAAACCCTTGCCCTGTCTTTGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.10% | 37.70% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 88.70% | 11.10% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 13.50% | 86.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 58.70% | 41.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 80.00% | 20.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 88.00% | 11.60% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 86.10% | 13.60% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 2.70% | 97.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 30.60% | 69.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 12.00% | 88.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 54.40% | 44.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0800347061 | A -> G | LOC_Os08g01580.1 | downstream_gene_variant ; 328.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800347061 | A -> G | LOC_Os08g01580-LOC_Os08g01590 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0800347061 | NA | 3.97E-10 | mr1277 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800347061 | NA | 8.51E-06 | mr1364 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800347061 | NA | 9.13E-08 | mr1423 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800347061 | 1.72E-07 | 3.07E-20 | mr1746 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800347061 | 1.02E-06 | 1.19E-08 | mr1746 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800347061 | NA | 7.16E-13 | mr1746 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800347061 | NA | 1.61E-06 | mr1805 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800347061 | NA | 8.37E-15 | mr1277_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800347061 | NA | 2.22E-06 | mr1558_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800347061 | 9.00E-10 | 1.69E-31 | mr1746_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800347061 | 9.09E-08 | 1.47E-10 | mr1746_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800347061 | 8.09E-07 | 1.13E-12 | mr1746_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |