\
| Variant ID: vg0800345996 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 345996 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, T: 0.05, others allele: 0.00, population size: 254. )
GTCCCTGGTGGTTCCATGGGCTACAAGGCTACCCAACAAGTTAAACAAGCTAAAAGGGTCACTACGCAGTCTCACCATACTATTCAATCCCCCGGATGCG[T/G]
TAGGCATGGAGGCCATTGGTGAGCTGAAAAATCTAAGGGACCTAAACATCTCTGTTAACAGGTGGCGGGACGATGAGATCCTTAGCCTTTATGCTCTGGG
CCCAGAGCATAAAGGCTAAGGATCTCATCGTCCCGCCACCTGTTAACAGAGATGTTTAGGTCCCTTAGATTTTTCAGCTCACCAATGGCCTCCATGCCTA[A/C]
CGCATCCGGGGGATTGAATAGTATGGTGAGACTGCGTAGTGACCCTTTTAGCTTGTTTAACTTGTTGGGTAGCCTTGTAGCCCATGGAACCACCAGGGAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.30% | 37.70% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 88.90% | 11.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 13.40% | 86.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 59.10% | 40.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 80.40% | 19.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 88.50% | 11.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 86.10% | 13.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 2.70% | 97.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 30.60% | 69.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 11.60% | 88.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 52.20% | 47.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0800345996 | T -> G | LOC_Os08g01580.1 | missense_variant ; p.Leu695Val; MODERATE | nonsynonymous_codon ; L695V | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | unknown | unknown | TOLERATED | 0.55 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0800345996 | NA | 2.23E-11 | mr1277 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800345996 | NA | 3.70E-06 | mr1364 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800345996 | NA | 1.46E-06 | mr1443 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800345996 | 1.05E-06 | 3.82E-20 | mr1746 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800345996 | 8.97E-06 | 1.01E-07 | mr1746 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800345996 | NA | 3.77E-12 | mr1746 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800345996 | NA | 4.74E-16 | mr1277_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800345996 | NA | 2.00E-06 | mr1558_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800345996 | 6.04E-10 | 1.91E-32 | mr1746_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800345996 | 1.04E-07 | 8.06E-11 | mr1746_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800345996 | 1.84E-07 | 1.20E-13 | mr1746_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |