\
| Variant ID: vg0800344884 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 344884 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.90, G: 0.11, others allele: 0.00, population size: 232. )
TGTGCCTTTCCAAACAATGGCAAAGGTAGCAGAGTGATAGTAACCACACGAGTGAAAGATGTGGCCAGGTTGGCATGTGGCAAGGATGGACAAATTTACA[A/G]
AATACAGCCTCTGAACAATAAGGACTCAAGAAAGTTATTCTTCGATAGAGTATTTAGGCCTGAAGATAGTTGTGTCCTGCAGTATGAAGAAATTTCAACT
AGTTGAAATTTCTTCATACTGCAGGACACAACTATCTTCAGGCCTAAATACTCTATCGAAGAATAACTTTCTTGAGTCCTTATTGTTCAGAGGCTGTATT[T/C]
TGTAAATTTGTCCATCCTTGCCACATGCCAACCTGGCCACATCTTTCACTCGTGTGGTTACTATCACTCTGCTACCTTTGCCATTGTTTGGAAAGGCACA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.90% | 43.90% | 0.11% | 0.11% | NA |
| All Indica | 2759 | 38.90% | 60.70% | 0.18% | 0.18% | NA |
| All Japonica | 1512 | 87.20% | 12.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 65.10% | 34.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 59.00% | 40.50% | 0.00% | 0.50% | NA |
| Indica II | 465 | 23.40% | 76.30% | 0.22% | 0.00% | NA |
| Indica III | 913 | 33.50% | 66.30% | 0.11% | 0.11% | NA |
| Indica Intermediate | 786 | 39.10% | 60.40% | 0.38% | 0.13% | NA |
| Temperate Japonica | 767 | 97.10% | 2.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 71.40% | 28.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 88.80% | 11.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 18.80% | 81.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 61.10% | 38.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0800344884 | A -> G | LOC_Os08g01580.1 | missense_variant ; p.Lys324Arg; MODERATE | nonsynonymous_codon ; K324R | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | benign |
0.455 |
TOLERATED | 0.89 |
| vg0800344884 | A -> DEL | LOC_Os08g01580.1 | N | frameshift_variant | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0800344884 | 1.34E-06 | 8.47E-11 | mr1277 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800344884 | 3.32E-07 | 4.60E-06 | mr1277 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800344884 | 1.99E-22 | 4.37E-45 | mr1746 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800344884 | 6.09E-20 | 4.49E-25 | mr1746 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800344884 | NA | 1.16E-13 | mr1746 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800344884 | NA | 7.62E-13 | mr1769 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800344884 | NA | 3.59E-12 | mr1055_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800344884 | 7.12E-12 | 1.74E-14 | mr1277_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800344884 | 4.25E-10 | 4.84E-07 | mr1277_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800344884 | 8.15E-08 | NA | mr1298_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800344884 | NA | 1.94E-07 | mr1676_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800344884 | NA | 6.53E-06 | mr1702_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800344884 | 9.01E-07 | NA | mr1731_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800344884 | 2.65E-26 | 7.88E-57 | mr1746_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800344884 | 5.69E-25 | 2.33E-33 | mr1746_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800344884 | 3.20E-06 | 1.25E-11 | mr1746_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800344884 | NA | 2.96E-13 | mr1769_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |