Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0800341637:

Variant ID: vg0800341637 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 341637
Reference Allele: G	Alternative Allele: C
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, G: 0.04, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

CAAGAGCAAGTAAAACTACCTTCATTTTTTTTAAAATATATCATACCGTTAACTTTATACATCATTGTGTCTGGATGCTTATAGTACTTGCTCTAAACTA[G/C]
TCACTCCATTCTAAATTGATCGTCTTACATGTTTATGCACCCAGACCAACGCTAATTTAAATCGCATCAATCAAGACACCATACACATATTATCTCACAA

Reverse complement sequence

TTGTGAGATAATATGTGTATGGTGTCTTGATTGATGCGATTTAAATTAGCGTTGGTCTGGGTGCATAAACATGTAAGACGATCAATTTAGAATGGAGTGA[C/G]
TAGTTTAGAGCAAGTACTATAAGCATCCAGACACAATGATGTATAAAGTTAACGGTATGATATATTTTAAAAAAAATGAAGGTAGTTTTACTTGCTCTTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.70%	29.30%	0.00%	0.00%	NA
All Indica	2759	98.70%	1.30%	0.00%	0.00%	NA
All Japonica	1512	13.80%	86.20%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	98.30%	1.70%	0.00%	0.00%	NA
Indica III	913	98.80%	1.20%	0.00%	0.00%	NA
Indica Intermediate	786	98.00%	2.00%	0.00%	0.00%	NA
Temperate Japonica	767	2.90%	97.10%	0.00%	0.00%	NA
Tropical Japonica	504	31.20%	68.80%	0.00%	0.00%	NA
Japonica Intermediate	241	12.00%	88.00%	0.00%	0.00%	NA
VI/Aromatic	96	87.50%	12.50%	0.00%	0.00%	NA
Intermediate	90	62.20%	37.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0800341637	G -> C	LOC_Os08g01570.1	upstream_gene_variant ; 3815.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800341637	G -> C	LOC_Os08g01580.1	upstream_gene_variant ; 578.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800341637	G -> C	LOC_Os08g01570-LOC_Os08g01580	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0800341637	NA	1.64E-31	mr1243	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800341637	NA	2.32E-10	mr1277	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800341637	NA	5.54E-06	mr1364	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800341637	NA	6.51E-27	mr1423	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800341637	NA	2.43E-06	mr1443	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800341637	NA	1.69E-38	mr1533	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800341637	4.14E-06	1.02E-13	mr1746	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800341637	NA	1.39E-11	mr1746	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800341637	NA	7.84E-13	mr1853	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800341637	NA	3.40E-34	mr1980	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800341637	NA	2.44E-71	mr1019_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800341637	NA	2.88E-17	mr1277_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800341637	NA	2.63E-06	mr1277_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800341637	NA	1.23E-20	mr1308_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800341637	NA	2.69E-11	mr1520_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800341637	NA	1.75E-38	mr1533_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800341637	NA	1.27E-24	mr1653_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800341637	1.20E-10	2.20E-24	mr1746_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800341637	2.74E-09	1.42E-14	mr1746_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251