Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0800341637:

Variant ID: vg0800341637 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 341637
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, G: 0.04, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


CAAGAGCAAGTAAAACTACCTTCATTTTTTTTAAAATATATCATACCGTTAACTTTATACATCATTGTGTCTGGATGCTTATAGTACTTGCTCTAAACTA[G/C]
TCACTCCATTCTAAATTGATCGTCTTACATGTTTATGCACCCAGACCAACGCTAATTTAAATCGCATCAATCAAGACACCATACACATATTATCTCACAA

Reverse complement sequence

TTGTGAGATAATATGTGTATGGTGTCTTGATTGATGCGATTTAAATTAGCGTTGGTCTGGGTGCATAAACATGTAAGACGATCAATTTAGAATGGAGTGA[C/G]
TAGTTTAGAGCAAGTACTATAAGCATCCAGACACAATGATGTATAAAGTTAACGGTATGATATATTTTAAAAAAAATGAAGGTAGTTTTACTTGCTCTTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.70% 29.30% 0.00% 0.00% NA
All Indica  2759 98.70% 1.30% 0.00% 0.00% NA
All Japonica  1512 13.80% 86.20% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 98.30% 1.70% 0.00% 0.00% NA
Indica III  913 98.80% 1.20% 0.00% 0.00% NA
Indica Intermediate  786 98.00% 2.00% 0.00% 0.00% NA
Temperate Japonica  767 2.90% 97.10% 0.00% 0.00% NA
Tropical Japonica  504 31.20% 68.80% 0.00% 0.00% NA
Japonica Intermediate  241 12.00% 88.00% 0.00% 0.00% NA
VI/Aromatic  96 87.50% 12.50% 0.00% 0.00% NA
Intermediate  90 62.20% 37.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0800341637 G -> C LOC_Os08g01570.1 upstream_gene_variant ; 3815.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800341637 G -> C LOC_Os08g01580.1 upstream_gene_variant ; 578.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800341637 G -> C LOC_Os08g01570-LOC_Os08g01580 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0800341637 NA 1.64E-31 mr1243 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800341637 NA 2.32E-10 mr1277 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800341637 NA 5.54E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800341637 NA 6.51E-27 mr1423 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800341637 NA 2.43E-06 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800341637 NA 1.69E-38 mr1533 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800341637 4.14E-06 1.02E-13 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800341637 NA 1.39E-11 mr1746 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800341637 NA 7.84E-13 mr1853 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800341637 NA 3.40E-34 mr1980 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800341637 NA 2.44E-71 mr1019_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800341637 NA 2.88E-17 mr1277_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800341637 NA 2.63E-06 mr1277_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800341637 NA 1.23E-20 mr1308_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800341637 NA 2.69E-11 mr1520_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800341637 NA 1.75E-38 mr1533_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800341637 NA 1.27E-24 mr1653_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800341637 1.20E-10 2.20E-24 mr1746_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800341637 2.74E-09 1.42E-14 mr1746_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251