\
| Variant ID: vg0800341569 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 341569 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.71, A: 0.31, others allele: 0.00, population size: 154. )
TCTTACTCCAGGATTCCCGCGAACGGATCAAAGCACTGGACGTATCGACGAATGTATCGCAAGAACTGCAAGAGCAAGTAAAACTACCTTCATTTTTTTT[A/T]
AAATATATCATACCGTTAACTTTATACATCATTGTGTCTGGATGCTTATAGTACTTGCTCTAAACTAGTCACTCCATTCTAAATTGATCGTCTTACATGT
ACATGTAAGACGATCAATTTAGAATGGAGTGACTAGTTTAGAGCAAGTACTATAAGCATCCAGACACAATGATGTATAAAGTTAACGGTATGATATATTT[T/A]
AAAAAAAATGAAGGTAGTTTTACTTGCTCTTGCAGTTCTTGCGATACATTCGTCGATACGTCCAGTGCTTTGATCCGTTCGCGGGAATCCTGGAGTAAGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.50% | 38.50% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 96.10% | 3.90% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 37.20% | 62.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 94.60% | 5.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 92.40% | 7.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 1.60% | 98.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 2.80% | 97.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.50% | 97.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 45.60% | 54.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0800341569 | A -> T | LOC_Os08g01570.1 | upstream_gene_variant ; 3747.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800341569 | A -> T | LOC_Os08g01580.1 | upstream_gene_variant ; 646.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800341569 | A -> T | LOC_Os08g01570-LOC_Os08g01580 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0800341569 | 2.14E-06 | 7.72E-17 | mr1746 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800341569 | NA | 7.26E-19 | mr1913 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800341569 | NA | 7.55E-21 | mr1298_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800341569 | NA | 1.36E-19 | mr1731_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800341569 | 3.03E-11 | 1.90E-30 | mr1746_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800341569 | NA | 1.90E-34 | mr1913_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |