\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0800338957:

Variant ID: vg0800338957 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 338957
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.03, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


TATATAATAAATTAGCTATAAGAGCAAGTTCAATAGTATAGCCCAATACTAACTCCAATTCATCTATAGCCAATATAATAGCCAATTTATACAATAGTTG[C/T]
TTACTATACTATTAATATACGGTCCCACCTGTCATACACTCATTGTGTCTTGAAGTCCGTGCTGCAACTGGCTACAGATCTGTAGCTCGCTGCTCCTCTC

Reverse complement sequence

GAGAGGAGCAGCGAGCTACAGATCTGTAGCCAGTTGCAGCACGGACTTCAAGACACAATGAGTGTATGACAGGTGGGACCGTATATTAATAGTATAGTAA[G/A]
CAACTATTGTATAAATTGGCTATTATATTGGCTATAGATGAATTGGAGTTAGTATTGGGCTATACTATTGAACTTGCTCTTATAGCTAATTTATTATATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.60% 37.20% 0.17% 0.00% NA
All Indica  2759 43.80% 55.90% 0.29% 0.00% NA
All Japonica  1512 99.00% 1.00% 0.00% 0.00% NA
Aus  269 64.70% 35.30% 0.00% 0.00% NA
Indica I  595 60.50% 38.50% 1.01% 0.00% NA
Indica II  465 23.90% 76.10% 0.00% 0.00% NA
Indica III  913 41.00% 59.00% 0.00% 0.00% NA
Indica Intermediate  786 46.20% 53.60% 0.25% 0.00% NA
Temperate Japonica  767 98.70% 1.30% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 18.80% 81.20% 0.00% 0.00% NA
Intermediate  90 70.00% 30.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0800338957 C -> T LOC_Os08g01570.1 upstream_gene_variant ; 1135.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800338957 C -> T LOC_Os08g01580.1 upstream_gene_variant ; 3258.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800338957 C -> T LOC_Os08g01570-LOC_Os08g01580 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0800338957 1.74E-07 5.76E-10 mr1277 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800338957 6.96E-08 3.02E-06 mr1277 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800338957 2.22E-19 2.39E-38 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800338957 7.28E-19 3.20E-26 mr1746 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800338957 2.16E-09 NA mr1277_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800338957 8.05E-09 NA mr1277_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800338957 NA 9.20E-18 mr1336_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800338957 NA 2.32E-06 mr1336_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800338957 NA 1.17E-11 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800338957 NA 6.33E-06 mr1360_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800338957 NA 2.04E-06 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800338957 NA 1.14E-06 mr1373_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800338957 NA 9.94E-06 mr1449_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800338957 NA 8.12E-16 mr1579_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800338957 NA 3.41E-19 mr1715_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800338957 5.33E-24 1.05E-49 mr1746_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800338957 3.79E-24 1.99E-31 mr1746_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251