\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0800307583:

Variant ID: vg0800307583 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 307583
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:


TCCCCTCTCCTCCTAGGGGGTTTTGTATTTATACCCATAGGTATCTCCTTGTCCAAGTAGAACTAGGGAAACTAATATGGATACAATCCGAGTAGTCCTG[G/A]
TCGTTTCCATGTAAAACTCTGGTTGTCTTTCTTTATCCGGAACTCCCTCCATATCCGCAGGTTGTTTCCGTATAGGACATGGTATGTGGTGGGCCCTGCC

Reverse complement sequence

GGCAGGGCCCACCACATACCATGTCCTATACGGAAACAACCTGCGGATATGGAGGGAGTTCCGGATAAAGAAAGACAACCAGAGTTTTACATGGAAACGA[C/T]
CAGGACTACTCGGATTGTATCCATATTAGTTTCCCTAGTTCTACTTGGACAAGGAGATACCTATGGGTATAAATACAAAACCCCCTAGGAGGAGAGGGGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.30% 32.80% 1.78% 0.15% NA
All Indica  2759 44.50% 54.40% 0.83% 0.22% NA
All Japonica  1512 98.50% 1.50% 0.07% 0.00% NA
Aus  269 77.70% 0.70% 21.19% 0.37% NA
Indica I  595 34.10% 65.20% 0.67% 0.00% NA
Indica II  465 19.40% 79.40% 0.65% 0.65% NA
Indica III  913 63.30% 35.90% 0.77% 0.00% NA
Indica Intermediate  786 45.40% 53.10% 1.15% 0.38% NA
Temperate Japonica  767 98.60% 1.40% 0.00% 0.00% NA
Tropical Japonica  504 98.40% 1.40% 0.20% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 2.10% 3.12% 0.00% NA
Intermediate  90 77.80% 22.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0800307583 G -> A LOC_Os08g01490.1 upstream_gene_variant ; 3527.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800307583 G -> A LOC_Os08g01500.1 upstream_gene_variant ; 125.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800307583 G -> A LOC_Os08g01510.1 upstream_gene_variant ; 745.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800307583 G -> A LOC_Os08g01500-LOC_Os08g01510 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800307583 G -> DEL N N silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0800307583 1.27E-06 NA mr1277 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800307583 5.53E-07 3.88E-10 mr1277 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800307583 NA 4.77E-12 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800307583 5.04E-08 NA mr1746 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800307583 1.25E-09 6.51E-11 mr1746 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800307583 3.32E-07 NA mr1277_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800307583 7.75E-08 1.44E-10 mr1277_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800307583 NA 3.74E-07 mr1403_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800307583 3.36E-08 NA mr1746_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800307583 1.00E-09 1.24E-12 mr1746_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251