\
| Variant ID: vg0800307583 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 307583 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 120. )
TCCCCTCTCCTCCTAGGGGGTTTTGTATTTATACCCATAGGTATCTCCTTGTCCAAGTAGAACTAGGGAAACTAATATGGATACAATCCGAGTAGTCCTG[G/A]
TCGTTTCCATGTAAAACTCTGGTTGTCTTTCTTTATCCGGAACTCCCTCCATATCCGCAGGTTGTTTCCGTATAGGACATGGTATGTGGTGGGCCCTGCC
GGCAGGGCCCACCACATACCATGTCCTATACGGAAACAACCTGCGGATATGGAGGGAGTTCCGGATAAAGAAAGACAACCAGAGTTTTACATGGAAACGA[C/T]
CAGGACTACTCGGATTGTATCCATATTAGTTTCCCTAGTTCTACTTGGACAAGGAGATACCTATGGGTATAAATACAAAACCCCCTAGGAGGAGAGGGGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.30% | 32.80% | 1.78% | 0.15% | NA |
| All Indica | 2759 | 44.50% | 54.40% | 0.83% | 0.22% | NA |
| All Japonica | 1512 | 98.50% | 1.50% | 0.07% | 0.00% | NA |
| Aus | 269 | 77.70% | 0.70% | 21.19% | 0.37% | NA |
| Indica I | 595 | 34.10% | 65.20% | 0.67% | 0.00% | NA |
| Indica II | 465 | 19.40% | 79.40% | 0.65% | 0.65% | NA |
| Indica III | 913 | 63.30% | 35.90% | 0.77% | 0.00% | NA |
| Indica Intermediate | 786 | 45.40% | 53.10% | 1.15% | 0.38% | NA |
| Temperate Japonica | 767 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.40% | 1.40% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 2.10% | 3.12% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 22.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0800307583 | G -> A | LOC_Os08g01490.1 | upstream_gene_variant ; 3527.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800307583 | G -> A | LOC_Os08g01500.1 | upstream_gene_variant ; 125.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800307583 | G -> A | LOC_Os08g01510.1 | upstream_gene_variant ; 745.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800307583 | G -> A | LOC_Os08g01500-LOC_Os08g01510 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800307583 | G -> DEL | N | N | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0800307583 | 1.27E-06 | NA | mr1277 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800307583 | 5.53E-07 | 3.88E-10 | mr1277 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800307583 | NA | 4.77E-12 | mr1352 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800307583 | 5.04E-08 | NA | mr1746 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800307583 | 1.25E-09 | 6.51E-11 | mr1746 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800307583 | 3.32E-07 | NA | mr1277_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800307583 | 7.75E-08 | 1.44E-10 | mr1277_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800307583 | NA | 3.74E-07 | mr1403_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800307583 | 3.36E-08 | NA | mr1746_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800307583 | 1.00E-09 | 1.24E-12 | mr1746_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |