Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0800307523:

Variant ID: vg0800307523 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 307523
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:

CTCGATCATGGTGACCGTGTTGATCATGTTGATCATGTCGATCGTCTGTCGATTGTCTTGTCCCCTCTCCTCCTAGGGGGTTTTGTATTTATACCCATAG[G/A]
TATCTCCTTGTCCAAGTAGAACTAGGGAAACTAATATGGATACAATCCGAGTAGTCCTGGTCGTTTCCATGTAAAACTCTGGTTGTCTTTCTTTATCCGG

Reverse complement sequence

CCGGATAAAGAAAGACAACCAGAGTTTTACATGGAAACGACCAGGACTACTCGGATTGTATCCATATTAGTTTCCCTAGTTCTACTTGGACAAGGAGATA[C/T]
CTATGGGTATAAATACAAAACCCCCTAGGAGGAGAGGGGACAAGACAATCGACAGACGATCGACATGATCAACATGATCAACACGGTCACCATGATCGAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.20%	21.10%	1.52%	0.23%	NA
All Indica	2759	68.00%	31.10%	0.51%	0.40%	NA
All Japonica	1512	99.70%	0.30%	0.07%	0.00%	NA
Aus	269	64.70%	15.20%	20.07%	0.00%	NA
Indica I	595	67.90%	31.30%	0.67%	0.17%	NA
Indica II	465	88.40%	10.50%	0.22%	0.86%	NA
Indica III	913	50.10%	49.20%	0.44%	0.33%	NA
Indica Intermediate	786	76.70%	22.30%	0.64%	0.38%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.20%	0.20%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	14.60%	83.30%	2.08%	0.00%	NA
Intermediate	90	86.70%	12.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0800307523	G -> A	LOC_Os08g01490.1	upstream_gene_variant ; 3467.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800307523	G -> A	LOC_Os08g01500.1	upstream_gene_variant ; 65.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800307523	G -> A	LOC_Os08g01510.1	upstream_gene_variant ; 805.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800307523	G -> A	LOC_Os08g01500-LOC_Os08g01510	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800307523	G -> DEL	N	N	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0800307523	1.88E-07	1.28E-12	mr1277	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800307523	1.17E-08	1.51E-11	mr1277	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800307523	4.54E-15	2.50E-27	mr1746	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800307523	1.67E-13	1.14E-16	mr1746	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800307523	1.36E-10	3.80E-19	mr1277_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800307523	5.45E-11	1.83E-12	mr1277_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800307523	3.08E-06	7.37E-08	mr1403_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800307523	1.05E-19	7.50E-36	mr1746_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800307523	1.66E-16	1.63E-21	mr1746_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251