| Variant ID: vg0800307523 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 307523 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 250. )
CTCGATCATGGTGACCGTGTTGATCATGTTGATCATGTCGATCGTCTGTCGATTGTCTTGTCCCCTCTCCTCCTAGGGGGTTTTGTATTTATACCCATAG[G/A]
TATCTCCTTGTCCAAGTAGAACTAGGGAAACTAATATGGATACAATCCGAGTAGTCCTGGTCGTTTCCATGTAAAACTCTGGTTGTCTTTCTTTATCCGG
CCGGATAAAGAAAGACAACCAGAGTTTTACATGGAAACGACCAGGACTACTCGGATTGTATCCATATTAGTTTCCCTAGTTCTACTTGGACAAGGAGATA[C/T]
CTATGGGTATAAATACAAAACCCCCTAGGAGGAGAGGGGACAAGACAATCGACAGACGATCGACATGATCAACATGATCAACACGGTCACCATGATCGAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 77.20% | 21.10% | 1.52% | 0.23% | NA |
| All Indica | 2759 | 68.00% | 31.10% | 0.51% | 0.40% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.07% | 0.00% | NA |
| Aus | 269 | 64.70% | 15.20% | 20.07% | 0.00% | NA |
| Indica I | 595 | 67.90% | 31.30% | 0.67% | 0.17% | NA |
| Indica II | 465 | 88.40% | 10.50% | 0.22% | 0.86% | NA |
| Indica III | 913 | 50.10% | 49.20% | 0.44% | 0.33% | NA |
| Indica Intermediate | 786 | 76.70% | 22.30% | 0.64% | 0.38% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 14.60% | 83.30% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 12.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0800307523 | G -> A | LOC_Os08g01490.1 | upstream_gene_variant ; 3467.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800307523 | G -> A | LOC_Os08g01500.1 | upstream_gene_variant ; 65.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800307523 | G -> A | LOC_Os08g01510.1 | upstream_gene_variant ; 805.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800307523 | G -> A | LOC_Os08g01500-LOC_Os08g01510 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800307523 | G -> DEL | N | N | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0800307523 | 1.88E-07 | 1.28E-12 | mr1277 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800307523 | 1.17E-08 | 1.51E-11 | mr1277 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800307523 | 4.54E-15 | 2.50E-27 | mr1746 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800307523 | 1.67E-13 | 1.14E-16 | mr1746 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800307523 | 1.36E-10 | 3.80E-19 | mr1277_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800307523 | 5.45E-11 | 1.83E-12 | mr1277_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800307523 | 3.08E-06 | 7.37E-08 | mr1403_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800307523 | 1.05E-19 | 7.50E-36 | mr1746_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800307523 | 1.66E-16 | 1.63E-21 | mr1746_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |