| Variant ID: vg0800302779 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 302779 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, A: 0.01, others allele: 0.00, population size: 222. )
TTTGGAAGAAACACATGTACAAAACTCAATTACCTAATTTTCGATTAATCTAGATGATAGAATTAATAGTAAAAAAGAAAGAAAAATTCAGAAGAACATA[T/A]
GTATAAGTGATTAATTACCATCAATATGGCATGGATATTGTGCCTGGTTAGATTGTACTCCTGTTGACGATCGAGCAGAATATCAACGAAATCTGACTCT
AGAGTCAGATTTCGTTGATATTCTGCTCGATCGTCAACAGGAGTACAATCTAACCAGGCACAATATCCATGCCATATTGATGGTAATTAATCACTTATAC[A/T]
TATGTTCTTCTGAATTTTTCTTTCTTTTTTACTATTAATTCTATCATCTAGATTAATCGAAAATTAGGTAATTGAGTTTTGTACATGTGTTTCTTCCAAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.70% | 31.10% | 0.19% | 0.00% | NA |
| All Indica | 2759 | 60.10% | 39.60% | 0.33% | 0.00% | NA |
| All Japonica | 1512 | 88.20% | 11.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 64.70% | 35.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 67.60% | 31.90% | 0.50% | 0.00% | NA |
| Indica II | 465 | 86.00% | 14.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 38.60% | 60.90% | 0.55% | 0.00% | NA |
| Indica Intermediate | 786 | 64.00% | 35.90% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 71.60% | 28.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 16.70% | 83.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 72.20% | 27.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0800302779 | T -> A | LOC_Os08g01480.1 | upstream_gene_variant ; 4412.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800302779 | T -> A | LOC_Os08g01500.1 | downstream_gene_variant ; 4389.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800302779 | T -> A | LOC_Os08g01490.1 | intron_variant ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0800302779 | NA | 5.82E-10 | mr1017 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800302779 | 6.49E-10 | 3.26E-18 | mr1277 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800302779 | 3.74E-12 | 1.64E-16 | mr1277 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800302779 | 1.16E-06 | NA | mr1298 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800302779 | NA | 5.63E-06 | mr1352 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800302779 | 4.40E-07 | NA | mr1731 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800302779 | 2.65E-22 | 1.10E-38 | mr1746 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800302779 | 4.97E-20 | 5.98E-24 | mr1746 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800302779 | NA | 2.73E-08 | mr1746 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800302779 | NA | 3.80E-12 | mr1055_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/