\
| Variant ID: vg0800292859 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 292859 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.71, G: 0.28, others allele: 0.00, population size: 232. )
TACCCATCAACTCTCCCTTCCCTCTCCCTCACCTCAGATTCTCCTCCCCTCACCTCAAATCCACGGCGGTGCTTGGCAGCAGCGGTGAAGGGGAGGGGCT[G/A]
TAGCGCTCAGTGCAAGTATTCCAATAAATTTGAGTATTTGAAATATTGGTTCCACCTTTCATATATATAGTATATGTTTATGCTTTACATGTTACAACAC
GTGTTGTAACATGTAAAGCATAAACATATACTATATATATGAAAGGTGGAACCAATATTTCAAATACTCAAATTTATTGGAATACTTGCACTGAGCGCTA[C/T]
AGCCCCTCCCCTTCACCGCTGCTGCCAAGCACCGCCGTGGATTTGAGGTGAGGGGAGGAGAATCTGAGGTGAGGGAGAGGGAAGGGAGAGTTGATGGGTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.30% | 31.70% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 13.20% | 86.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 73.60% | 26.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.40% | 4.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 2.90% | 97.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 29.60% | 70.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 11.60% | 88.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 87.50% | 12.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 55.60% | 44.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0800292859 | G -> A | LOC_Os08g01450.1 | upstream_gene_variant ; 2558.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800292859 | G -> A | LOC_Os08g01460.1 | downstream_gene_variant ; 786.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800292859 | G -> A | LOC_Os08g01470.1 | downstream_gene_variant ; 518.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800292859 | G -> A | LOC_Os08g01480.1 | downstream_gene_variant ; 4049.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800292859 | G -> A | LOC_Os08g01460-LOC_Os08g01470 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0800292859 | NA | 5.88E-35 | mr1243 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800292859 | NA | 1.07E-17 | mr1253 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800292859 | NA | 2.77E-27 | mr1423 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800292859 | 6.61E-08 | 2.48E-19 | mr1746 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800292859 | NA | 5.99E-11 | mr1746 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800292859 | NA | 6.62E-10 | mr1790 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800292859 | 5.28E-06 | 1.09E-08 | mr1020_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800292859 | 3.96E-06 | NA | mr1027_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800292859 | NA | 1.63E-06 | mr1039_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800292859 | NA | 8.35E-13 | mr1151_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800292859 | NA | 3.92E-07 | mr1153_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800292859 | NA | 2.38E-09 | mr1198_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800292859 | NA | 4.29E-15 | mr1217_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800292859 | NA | 7.24E-12 | mr1228_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800292859 | NA | 3.50E-09 | mr1232_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800292859 | NA | 3.39E-06 | mr1262_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800292859 | NA | 1.60E-06 | mr1272_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800292859 | NA | 2.39E-07 | mr1275_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800292859 | 8.52E-06 | 6.56E-27 | mr1298_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800292859 | NA | 4.33E-07 | mr1302_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800292859 | NA | 9.39E-22 | mr1308_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800292859 | NA | 5.38E-24 | mr1401_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800292859 | NA | 9.08E-06 | mr1407_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800292859 | NA | 5.40E-07 | mr1418_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800292859 | NA | 2.15E-06 | mr1488_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800292859 | NA | 3.95E-10 | mr1506_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800292859 | NA | 1.09E-15 | mr1529_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800292859 | NA | 4.66E-06 | mr1557_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800292859 | NA | 4.51E-07 | mr1558_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800292859 | NA | 2.71E-16 | mr1575_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800292859 | NA | 5.60E-08 | mr1604_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800292859 | NA | 1.73E-07 | mr1632_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800292859 | NA | 4.98E-12 | mr1641_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800292859 | NA | 9.93E-09 | mr1659_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800292859 | NA | 2.53E-06 | mr1662_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800292859 | NA | 1.05E-10 | mr1667_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800292859 | NA | 2.28E-07 | mr1676_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800292859 | NA | 5.53E-12 | mr1714_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800292859 | NA | 9.36E-26 | mr1731_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800292859 | 9.70E-06 | 6.26E-27 | mr1746_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800292859 | NA | 2.56E-08 | mr1746_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800292859 | NA | 2.61E-15 | mr1767_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800292859 | NA | 6.66E-09 | mr1824_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800292859 | NA | 5.31E-09 | mr1835_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800292859 | NA | 9.15E-14 | mr1838_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800292859 | NA | 2.09E-06 | mr1869_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800292859 | NA | 5.07E-32 | mr1873_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800292859 | NA | 3.04E-07 | mr1885_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800292859 | NA | 5.72E-08 | mr1909_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800292859 | NA | 3.84E-08 | mr1921_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800292859 | NA | 1.68E-22 | mr1922_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800292859 | NA | 5.13E-24 | mr1924_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800292859 | NA | 3.18E-10 | mr1940_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800292859 | NA | 3.24E-13 | mr1986_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |