\
| Variant ID: vg0800291060 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 291060 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 122. )
CACGCACTCAAGTACGTACGTTGCCAAATGTGATGCGCCGGTTAATTGTTGCGATTCGCCAACAATTAATATATTAATCTATCGGCTCATGAACAATTAA[G/A]
CATTAATTATGGAATTGCTATATGTCATTTGAATGAAATTTGGGGATGAAATCTTAAAGATTTTGAACCATTGGATCCATGCCAAGATTCGTGCATCGGC
GCCGATGCACGAATCTTGGCATGGATCCAATGGTTCAAAATCTTTAAGATTTCATCCCCAAATTTCATTCAAATGACATATAGCAATTCCATAATTAATG[C/T]
TTAATTGTTCATGAGCCGATAGATTAATATATTAATTGTTGGCGAATCGCAACAATTAACCGGCGCATCACATTTGGCAACGTACGTACTTGAGTGCGTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 31.70% | 30.10% | 27.95% | 10.26% | NA |
| All Indica | 2759 | 4.00% | 36.50% | 43.24% | 16.27% | NA |
| All Japonica | 1512 | 86.80% | 11.80% | 1.12% | 0.33% | NA |
| Aus | 269 | 9.30% | 50.60% | 31.60% | 8.55% | NA |
| Indica I | 595 | 3.20% | 32.10% | 49.92% | 14.79% | NA |
| Indica II | 465 | 3.00% | 14.60% | 60.86% | 21.51% | NA |
| Indica III | 913 | 3.30% | 54.40% | 27.27% | 15.01% | NA |
| Indica Intermediate | 786 | 6.00% | 31.90% | 46.31% | 15.78% | NA |
| Temperate Japonica | 767 | 97.10% | 1.40% | 1.04% | 0.39% | NA |
| Tropical Japonica | 504 | 70.20% | 28.40% | 1.19% | 0.20% | NA |
| Japonica Intermediate | 241 | 88.40% | 10.00% | 1.24% | 0.41% | NA |
| VI/Aromatic | 96 | 10.40% | 84.40% | 4.17% | 1.04% | NA |
| Intermediate | 90 | 44.40% | 23.30% | 24.44% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0800291060 | G -> A | LOC_Os08g01450.1 | upstream_gene_variant ; 759.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800291060 | G -> A | LOC_Os08g01460.1 | upstream_gene_variant ; 235.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800291060 | G -> A | LOC_Os08g01470.1 | downstream_gene_variant ; 2317.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800291060 | G -> A | LOC_Os08g01450-LOC_Os08g01460 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800291060 | G -> DEL | N | N | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0800291060 | 1.43E-06 | 6.83E-13 | mr1277 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800291060 | 3.44E-08 | 1.74E-11 | mr1277 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800291060 | 9.96E-14 | 7.60E-21 | mr1746 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800291060 | 6.75E-11 | 2.32E-12 | mr1746 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800291060 | NA | 2.45E-09 | mr1746 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800291060 | NA | 7.34E-12 | mr1055_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800291060 | 1.54E-10 | 2.57E-20 | mr1277_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800291060 | 4.70E-11 | 2.89E-13 | mr1277_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800291060 | 9.79E-07 | NA | mr1298_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800291060 | 1.92E-06 | 3.69E-07 | mr1298_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800291060 | NA | 9.87E-07 | mr1632_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800291060 | NA | 9.09E-08 | mr1676_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800291060 | 8.39E-07 | NA | mr1731_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800291060 | 3.28E-06 | 3.48E-07 | mr1731_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800291060 | 9.77E-15 | 2.76E-22 | mr1746_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800291060 | 1.08E-11 | 1.30E-15 | mr1746_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800291060 | NA | 7.20E-11 | mr1942_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |