Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0800291060:

Variant ID: vg0800291060 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 291060
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:

CACGCACTCAAGTACGTACGTTGCCAAATGTGATGCGCCGGTTAATTGTTGCGATTCGCCAACAATTAATATATTAATCTATCGGCTCATGAACAATTAA[G/A]
CATTAATTATGGAATTGCTATATGTCATTTGAATGAAATTTGGGGATGAAATCTTAAAGATTTTGAACCATTGGATCCATGCCAAGATTCGTGCATCGGC

Reverse complement sequence

GCCGATGCACGAATCTTGGCATGGATCCAATGGTTCAAAATCTTTAAGATTTCATCCCCAAATTTCATTCAAATGACATATAGCAATTCCATAATTAATG[C/T]
TTAATTGTTCATGAGCCGATAGATTAATATATTAATTGTTGGCGAATCGCAACAATTAACCGGCGCATCACATTTGGCAACGTACGTACTTGAGTGCGTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	31.70%	30.10%	27.95%	10.26%	NA
All Indica	2759	4.00%	36.50%	43.24%	16.27%	NA
All Japonica	1512	86.80%	11.80%	1.12%	0.33%	NA
Aus	269	9.30%	50.60%	31.60%	8.55%	NA
Indica I	595	3.20%	32.10%	49.92%	14.79%	NA
Indica II	465	3.00%	14.60%	60.86%	21.51%	NA
Indica III	913	3.30%	54.40%	27.27%	15.01%	NA
Indica Intermediate	786	6.00%	31.90%	46.31%	15.78%	NA
Temperate Japonica	767	97.10%	1.40%	1.04%	0.39%	NA
Tropical Japonica	504	70.20%	28.40%	1.19%	0.20%	NA
Japonica Intermediate	241	88.40%	10.00%	1.24%	0.41%	NA
VI/Aromatic	96	10.40%	84.40%	4.17%	1.04%	NA
Intermediate	90	44.40%	23.30%	24.44%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0800291060	G -> A	LOC_Os08g01450.1	upstream_gene_variant ; 759.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800291060	G -> A	LOC_Os08g01460.1	upstream_gene_variant ; 235.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800291060	G -> A	LOC_Os08g01470.1	downstream_gene_variant ; 2317.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800291060	G -> A	LOC_Os08g01450-LOC_Os08g01460	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800291060	G -> DEL	N	N	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0800291060	1.43E-06	6.83E-13	mr1277	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800291060	3.44E-08	1.74E-11	mr1277	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800291060	9.96E-14	7.60E-21	mr1746	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800291060	6.75E-11	2.32E-12	mr1746	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800291060	NA	2.45E-09	mr1746	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800291060	NA	7.34E-12	mr1055_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800291060	1.54E-10	2.57E-20	mr1277_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800291060	4.70E-11	2.89E-13	mr1277_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800291060	9.79E-07	NA	mr1298_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800291060	1.92E-06	3.69E-07	mr1298_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800291060	NA	9.87E-07	mr1632_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800291060	NA	9.09E-08	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800291060	8.39E-07	NA	mr1731_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800291060	3.28E-06	3.48E-07	mr1731_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800291060	9.77E-15	2.76E-22	mr1746_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800291060	1.08E-11	1.30E-15	mr1746_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800291060	NA	7.20E-11	mr1942_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251