\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0800291060:

Variant ID: vg0800291060 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 291060
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


CACGCACTCAAGTACGTACGTTGCCAAATGTGATGCGCCGGTTAATTGTTGCGATTCGCCAACAATTAATATATTAATCTATCGGCTCATGAACAATTAA[G/A]
CATTAATTATGGAATTGCTATATGTCATTTGAATGAAATTTGGGGATGAAATCTTAAAGATTTTGAACCATTGGATCCATGCCAAGATTCGTGCATCGGC

Reverse complement sequence

GCCGATGCACGAATCTTGGCATGGATCCAATGGTTCAAAATCTTTAAGATTTCATCCCCAAATTTCATTCAAATGACATATAGCAATTCCATAATTAATG[C/T]
TTAATTGTTCATGAGCCGATAGATTAATATATTAATTGTTGGCGAATCGCAACAATTAACCGGCGCATCACATTTGGCAACGTACGTACTTGAGTGCGTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 31.70% 30.10% 27.95% 10.26% NA
All Indica  2759 4.00% 36.50% 43.24% 16.27% NA
All Japonica  1512 86.80% 11.80% 1.12% 0.33% NA
Aus  269 9.30% 50.60% 31.60% 8.55% NA
Indica I  595 3.20% 32.10% 49.92% 14.79% NA
Indica II  465 3.00% 14.60% 60.86% 21.51% NA
Indica III  913 3.30% 54.40% 27.27% 15.01% NA
Indica Intermediate  786 6.00% 31.90% 46.31% 15.78% NA
Temperate Japonica  767 97.10% 1.40% 1.04% 0.39% NA
Tropical Japonica  504 70.20% 28.40% 1.19% 0.20% NA
Japonica Intermediate  241 88.40% 10.00% 1.24% 0.41% NA
VI/Aromatic  96 10.40% 84.40% 4.17% 1.04% NA
Intermediate  90 44.40% 23.30% 24.44% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0800291060 G -> A LOC_Os08g01450.1 upstream_gene_variant ; 759.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800291060 G -> A LOC_Os08g01460.1 upstream_gene_variant ; 235.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800291060 G -> A LOC_Os08g01470.1 downstream_gene_variant ; 2317.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800291060 G -> A LOC_Os08g01450-LOC_Os08g01460 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800291060 G -> DEL N N silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0800291060 1.43E-06 6.83E-13 mr1277 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800291060 3.44E-08 1.74E-11 mr1277 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800291060 9.96E-14 7.60E-21 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800291060 6.75E-11 2.32E-12 mr1746 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800291060 NA 2.45E-09 mr1746 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800291060 NA 7.34E-12 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800291060 1.54E-10 2.57E-20 mr1277_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800291060 4.70E-11 2.89E-13 mr1277_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800291060 9.79E-07 NA mr1298_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800291060 1.92E-06 3.69E-07 mr1298_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800291060 NA 9.87E-07 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800291060 NA 9.09E-08 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800291060 8.39E-07 NA mr1731_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800291060 3.28E-06 3.48E-07 mr1731_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800291060 9.77E-15 2.76E-22 mr1746_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800291060 1.08E-11 1.30E-15 mr1746_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800291060 NA 7.20E-11 mr1942_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251