\
| Variant ID: vg0800289042 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 289042 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, T: 0.13, others allele: 0.00, population size: 254. )
AGTTCATACCTGGGCATATCCTCCGACCAGTTCCGAATGGCAAGAAATTGAAATTATTTCCATTGTACCCAGCCATTGTGTTGCTAAGGAACCTCTCTGG[C/T]
ATGAACTCCTCGGCATTTTCCCAATAGCTAGGGTCCCTGGCAATAGCCCATGCATTGACGATGACACGAGTGCCTGAGGGTATAGTATAGCCCTCAACAT
ATGTTGAGGGCTATACTATACCCTCAGGCACTCGTGTCATCGTCAATGCATGGGCTATTGCCAGGGACCCTAGCTATTGGGAAAATGCCGAGGAGTTCAT[G/A]
CCAGAGAGGTTCCTTAGCAACACAATGGCTGGGTACAATGGAAATAATTTCAATTTCTTGCCATTCGGAACTGGTCGGAGGATATGCCCAGGTATGAACT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.30% | 42.50% | 0.17% | 0.11% | NA |
| All Indica | 2759 | 41.20% | 58.40% | 0.29% | 0.14% | NA |
| All Japonica | 1512 | 87.50% | 12.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 65.40% | 34.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 57.80% | 41.70% | 0.34% | 0.17% | NA |
| Indica II | 465 | 23.90% | 75.90% | 0.22% | 0.00% | NA |
| Indica III | 913 | 37.80% | 61.70% | 0.33% | 0.22% | NA |
| Indica Intermediate | 786 | 42.90% | 56.70% | 0.25% | 0.13% | NA |
| Temperate Japonica | 767 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 71.60% | 28.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 89.20% | 10.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 16.70% | 83.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 60.00% | 38.90% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0800289042 | C -> T | LOC_Os08g01450.1 | missense_variant ; p.Met420Ile; MODERATE | nonsynonymous_codon ; M420I | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | benign |
0.291 |
TOLERATED | 0.40 |
| vg0800289042 | C -> DEL | LOC_Os08g01450.1 | N | frameshift_variant | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0800289042 | 3.10E-08 | 1.87E-13 | mr1277 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800289042 | 1.14E-08 | 8.10E-08 | mr1277 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800289042 | 1.38E-24 | 1.66E-50 | mr1746 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800289042 | 1.20E-20 | 5.22E-27 | mr1746 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800289042 | NA | 2.12E-11 | mr1746 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800289042 | 9.97E-11 | 1.27E-14 | mr1277_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800289042 | 1.85E-10 | 1.66E-07 | mr1277_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800289042 | 1.66E-06 | NA | mr1298_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800289042 | NA | 9.06E-06 | mr1582_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800289042 | NA | 1.47E-06 | mr1632_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800289042 | NA | 2.68E-07 | mr1676_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800289042 | 1.93E-30 | 1.32E-64 | mr1746_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800289042 | 8.72E-27 | 1.96E-37 | mr1746_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800289042 | NA | 6.01E-10 | mr1746_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |