Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0800272949:

Variant ID: vg0800272949 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 272949
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.73, T: 0.26, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:

ATATAGAGGTCAACACTCACCACAAATATCATTAATTCATATCAAGGACACATATAAATTCATCATCTGGAGATATAGCTACACTACTTATTAATCCAAC[C/T]
ACAGAATCTCTAATATGATATAGGAGTACTATTTACTATAGGAATGAATATTCAGGGTTAGTCATACACTCAAACTATATACTAGTACTACTTACATGCT

Reverse complement sequence

AGCATGTAAGTAGTACTAGTATATAGTTTGAGTGTATGACTAACCCTGAATATTCATTCCTATAGTAAATAGTACTCCTATATCATATTAGAGATTCTGT[G/A]
GTTGGATTAATAAGTAGTGTAGCTATATCTCCAGATGATGAATTTATATGTGTCCTTGATATGAATTAATGATATTTGTGGTGAGTGTTGACCTCTATAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.00%	45.20%	0.74%	0.02%	NA
All Indica	2759	74.00%	24.80%	1.20%	0.04%	NA
All Japonica	1512	12.70%	87.20%	0.07%	0.00%	NA
Aus	269	72.90%	26.80%	0.37%	0.00%	NA
Indica I	595	77.80%	19.50%	2.69%	0.00%	NA
Indica II	465	81.30%	18.50%	0.22%	0.00%	NA
Indica III	913	65.50%	34.20%	0.33%	0.00%	NA
Indica Intermediate	786	76.70%	21.50%	1.65%	0.13%	NA
Temperate Japonica	767	2.60%	97.40%	0.00%	0.00%	NA
Tropical Japonica	504	29.00%	70.80%	0.20%	0.00%	NA
Japonica Intermediate	241	10.80%	89.20%	0.00%	0.00%	NA
VI/Aromatic	96	84.40%	15.60%	0.00%	0.00%	NA
Intermediate	90	46.70%	53.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0800272949	C -> T	LOC_Os08g01420.1	3_prime_UTR_variant ; 634.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800272949	C -> T	LOC_Os08g01410.1	upstream_gene_variant ; 872.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800272949	C -> DEL	N	N	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0800272949	C	T	-0.02	-0.07	-0.08	-0.03	-0.04	-0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0800272949	NA	4.85E-11	mr1277	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800272949	3.05E-06	NA	mr1277	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800272949	1.08E-12	2.38E-26	mr1746	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800272949	4.50E-09	3.39E-11	mr1746	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800272949	NA	9.80E-11	mr1746	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800272949	NA	2.13E-06	mr1039_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800272949	8.22E-06	1.22E-20	mr1298_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800272949	NA	1.16E-06	mr1558_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800272949	NA	1.27E-07	mr1632_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800272949	NA	2.69E-06	mr1702_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800272949	NA	1.70E-20	mr1731_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800272949	4.59E-15	1.77E-37	mr1746_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800272949	5.23E-11	6.05E-15	mr1746_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800272949	NA	8.41E-10	mr1746_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251