\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0800226466:

Variant ID: vg0800226466 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 226466
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCTCTTCCCTTGAAAGGCCACATGCTGATTTGTTTCTCATACTCCTTCCGTTTTGAAATGTTTGACACAATTAACTTTTTAGCACATGTTTGACCGTTC[G/A]
TCTTATTCAAAAATTTTTGTGAAATATGTTTGATTGAGAAAATCCCTTATATACCCCTGAAATTTTTCCTAATCCCTTCTATACCCCTGAATTTTGCTTA

Reverse complement sequence

TAAGCAAAATTCAGGGGTATAGAAGGGATTAGGAAAAATTTCAGGGGTATATAAGGGATTTTCTCAATCAAACATATTTCACAAAAATTTTTGAATAAGA[C/T]
GAACGGTCAAACATGTGCTAAAAAGTTAATTGTGTCAAACATTTCAAAACGGAAGGAGTATGAGAAACAAATCAGCATGTGGCCTTTCAAGGGAAGAGAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.30% 16.00% 10.66% 41.05% NA
All Indica  2759 5.20% 24.10% 9.42% 61.33% NA
All Japonica  1512 87.00% 0.50% 1.65% 10.85% NA
Aus  269 5.20% 4.10% 75.84% 14.87% NA
Indica I  595 9.20% 20.50% 8.57% 61.68% NA
Indica II  465 4.50% 8.20% 4.95% 82.37% NA
Indica III  913 1.50% 38.70% 8.98% 50.82% NA
Indica Intermediate  786 6.70% 19.20% 13.23% 60.81% NA
Temperate Japonica  767 97.30% 0.30% 0.13% 2.35% NA
Tropical Japonica  504 70.80% 0.60% 4.37% 24.21% NA
Japonica Intermediate  241 88.40% 0.80% 0.83% 9.96% NA
VI/Aromatic  96 13.50% 67.70% 5.21% 13.54% NA
Intermediate  90 45.60% 8.90% 11.11% 34.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0800226466 G -> A LOC_Os08g01350.1 upstream_gene_variant ; 1104.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800226466 G -> A LOC_Os08g01360.1 upstream_gene_variant ; 1747.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800226466 G -> A LOC_Os08g01350.2 upstream_gene_variant ; 1104.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800226466 G -> A LOC_Os08g01360.3 upstream_gene_variant ; 1747.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800226466 G -> A LOC_Os08g01360.2 upstream_gene_variant ; 1749.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800226466 G -> A LOC_Os08g01350-LOC_Os08g01360 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800226466 G -> DEL N N silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0800226466 NA 4.27E-10 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800226466 3.37E-08 3.26E-11 mr1277 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800226466 1.90E-09 9.98E-12 mr1277 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800226466 4.93E-07 4.92E-07 mr1366 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800226466 NA 1.51E-10 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800226466 NA 3.06E-06 mr1393 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800226466 NA 3.30E-11 mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800226466 NA 2.66E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800226466 7.04E-18 3.66E-29 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800226466 9.43E-15 2.20E-17 mr1746 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800226466 NA 8.02E-10 mr1746 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800226466 NA 5.18E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800226466 NA 3.00E-14 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800226466 NA 1.03E-06 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800226466 NA 1.54E-06 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800226466 1.81E-06 1.81E-06 mr1883 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800226466 NA 9.83E-07 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800226466 NA 1.29E-09 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800226466 NA 4.17E-06 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800226466 NA 7.05E-13 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800226466 2.09E-09 NA mr1277_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800226466 1.65E-08 3.58E-11 mr1277_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800226466 NA 4.09E-06 mr1403_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800226466 NA 3.84E-07 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800226466 NA 4.44E-08 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800226466 1.08E-16 3.16E-26 mr1746_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800226466 3.98E-14 1.01E-19 mr1746_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800226466 NA 4.90E-14 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251