\
| Variant ID: vg0800202591 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 202591 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.84, T: 0.16, others allele: 0.00, population size: 218. )
AATTATTTTGGAACCAATTTTGAGGACAAGAGGTGGATACTTGCATTGTTAGAGGCTATCTTCAGGTCCAAAAACTCAACATCAATAGTGAAACGCCCAG[C/T]
GTACATCGTATCAAGTTGCCAGAAAAAGTCTTCGCTGCTTCGGAGGAGATGCTCATGCACTGTCAGGAAAAATTGGACAATACTTATGAAGATCAATGAG
CTCATTGATCTTCATAAGTATTGTCCAATTTTTCCTGACAGTGCATGAGCATCTCCTCCGAAGCAGCGAAGACTTTTTCTGGCAACTTGATACGATGTAC[G/A]
CTGGGCGTTTCACTATTGATGTTGAGTTTTTGGACCTGAAGATAGCCTCTAACAATGCAAGTATCCACCTCTTGTCCTCAAAATTGGTTCCAAAATAATT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.00% | 27.00% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 62.20% | 37.70% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 50.90% | 49.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 74.80% | 25.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 83.70% | 16.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 42.70% | 57.20% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 62.60% | 37.30% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 18.80% | 81.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 22.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0800202591 | C -> T | LOC_Os08g01320.1 | missense_variant ; p.Ala161Thr; MODERATE | nonsynonymous_codon ; A161T | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | benign |
0.131 |
TOLERATED | 0.40 |
| vg0800202591 | C -> T | LOC_Os08g01320.2 | missense_variant ; p.Ala108Thr; MODERATE | nonsynonymous_codon ; A108T | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | benign |
0.131 |
TOLERATED | 0.64 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0800202591 | 2.17E-11 | 3.18E-17 | mr1277 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800202591 | 1.02E-11 | 4.87E-14 | mr1277 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800202591 | NA | 3.84E-06 | mr1352 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800202591 | 2.43E-17 | 2.30E-26 | mr1746 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800202591 | 4.23E-16 | 5.80E-18 | mr1746 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800202591 | 7.22E-06 | 7.22E-06 | mr1811 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800202591 | 7.05E-08 | 8.80E-19 | mr1277_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800202591 | 1.03E-07 | 1.56E-10 | mr1277_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800202591 | NA | 1.16E-06 | mr1403_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800202591 | 3.37E-15 | 1.38E-30 | mr1746_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800202591 | 1.24E-14 | 5.81E-20 | mr1746_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |