\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0800202591:

Variant ID: vg0800202591 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 202591
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.84, T: 0.16, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


AATTATTTTGGAACCAATTTTGAGGACAAGAGGTGGATACTTGCATTGTTAGAGGCTATCTTCAGGTCCAAAAACTCAACATCAATAGTGAAACGCCCAG[C/T]
GTACATCGTATCAAGTTGCCAGAAAAAGTCTTCGCTGCTTCGGAGGAGATGCTCATGCACTGTCAGGAAAAATTGGACAATACTTATGAAGATCAATGAG

Reverse complement sequence

CTCATTGATCTTCATAAGTATTGTCCAATTTTTCCTGACAGTGCATGAGCATCTCCTCCGAAGCAGCGAAGACTTTTTCTGGCAACTTGATACGATGTAC[G/A]
CTGGGCGTTTCACTATTGATGTTGAGTTTTTGGACCTGAAGATAGCCTCTAACAATGCAAGTATCCACCTCTTGTCCTCAAAATTGGTTCCAAAATAATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.00% 27.00% 0.04% 0.00% NA
All Indica  2759 62.20% 37.70% 0.07% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 50.90% 49.10% 0.00% 0.00% NA
Indica I  595 74.80% 25.20% 0.00% 0.00% NA
Indica II  465 83.70% 16.30% 0.00% 0.00% NA
Indica III  913 42.70% 57.20% 0.11% 0.00% NA
Indica Intermediate  786 62.60% 37.30% 0.13% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 18.80% 81.20% 0.00% 0.00% NA
Intermediate  90 77.80% 22.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0800202591 C -> T LOC_Os08g01320.1 missense_variant ; p.Ala161Thr; MODERATE nonsynonymous_codon ; A161T Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 benign 0.131 TOLERATED 0.40
vg0800202591 C -> T LOC_Os08g01320.2 missense_variant ; p.Ala108Thr; MODERATE nonsynonymous_codon ; A108T Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 benign 0.131 TOLERATED 0.64

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0800202591 2.17E-11 3.18E-17 mr1277 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800202591 1.02E-11 4.87E-14 mr1277 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800202591 NA 3.84E-06 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800202591 2.43E-17 2.30E-26 mr1746 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800202591 4.23E-16 5.80E-18 mr1746 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800202591 7.22E-06 7.22E-06 mr1811 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800202591 7.05E-08 8.80E-19 mr1277_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800202591 1.03E-07 1.56E-10 mr1277_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800202591 NA 1.16E-06 mr1403_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800202591 3.37E-15 1.38E-30 mr1746_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800202591 1.24E-14 5.81E-20 mr1746_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251