\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0800195356:

Variant ID: vg0800195356 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 195356
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.76, G: 0.25, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


TTGCGTTGTGATACTACTATAAAAAAAAGTTGCATGTTCATAAATTGTGGGAGTACAGGTAACCAGGGACCATTTATGCTGGTGACATGTTGTACAGGAA[A/G]
GACAATGGACCATCACTGTTGCAGTGGAATCTGGCATAGCAAAGCATCAGATCCCTTGATTATAAGAGATCAATGTCTCCCTTAATTGTCACTCACATGT

Reverse complement sequence

ACATGTGAGTGACAATTAAGGGAGACATTGATCTCTTATAATCAAGGGATCTGATGCTTTGCTATGCCAGATTCCACTGCAACAGTGATGGTCCATTGTC[T/C]
TTCCTGTACAACATGTCACCAGCATAAATGGTCCCTGGTTACCTGTACTCCCACAATTTATGAACATGCAACTTTTTTTTATAGTAGTATCACAACGCAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.10% 26.70% 0.21% 0.00% NA
All Indica  2759 59.60% 40.10% 0.33% 0.00% NA
All Japonica  1512 99.30% 0.70% 0.00% 0.00% NA
Aus  269 53.20% 46.80% 0.00% 0.00% NA
Indica I  595 44.00% 55.50% 0.50% 0.00% NA
Indica II  465 78.10% 21.70% 0.22% 0.00% NA
Indica III  913 58.90% 41.00% 0.11% 0.00% NA
Indica Intermediate  786 61.30% 38.20% 0.51% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 98.60% 1.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 82.20% 16.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0800195356 A -> G LOC_Os08g01300.1 upstream_gene_variant ; 851.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800195356 A -> G LOC_Os08g01290.1 downstream_gene_variant ; 3476.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800195356 A -> G LOC_Os08g01310.1 downstream_gene_variant ; 457.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800195356 A -> G LOC_Os08g01290.6 downstream_gene_variant ; 3477.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800195356 A -> G LOC_Os08g01290.7 downstream_gene_variant ; 3477.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800195356 A -> G LOC_Os08g01290.4 downstream_gene_variant ; 3477.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800195356 A -> G LOC_Os08g01290.3 downstream_gene_variant ; 3477.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800195356 A -> G LOC_Os08g01290.2 downstream_gene_variant ; 3477.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800195356 A -> G LOC_Os08g01290.5 downstream_gene_variant ; 3477.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800195356 A -> G LOC_Os08g01300-LOC_Os08g01310 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0800195356 A G 0.0 0.02 0.0 0.02 0.06 0.11

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0800195356 1.82E-09 NA mr1277 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800195356 3.60E-09 2.59E-08 mr1277 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800195356 NA 7.78E-06 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800195356 NA 9.28E-06 mr1724 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800195356 6.80E-17 1.12E-11 mr1746 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800195356 8.06E-16 6.49E-20 mr1746 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800195356 6.79E-06 6.74E-06 mr1954 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800195356 2.76E-08 NA mr1277_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800195356 2.61E-08 1.57E-06 mr1277_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800195356 5.14E-18 NA mr1746_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800195356 7.53E-20 3.53E-26 mr1746_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251