\
| Variant ID: vg0800185506 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 185506 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.73, A: 0.26, others allele: 0.00, population size: 232. )
CTCTCTTTCTACTCCTAAGTACTAAGTAATTAAGAGGAGTCTTAATGGTTAAGTATATATTAGCCGCCTCCATTGATCGATCCATCGATATCATCATCAG[T/A]
GTGAGGACGTCCCGTCCCGTCCGTCGTCCTCCCCGCTAGCAACAATGCAAAAGCTGCAGATCCATCCATCCATCGATACACACCATGCATTAATCAAATC
GATTTGATTAATGCATGGTGTGTATCGATGGATGGATGGATCTGCAGCTTTTGCATTGTTGCTAGCGGGGAGGACGACGGACGGGACGGGACGTCCTCAC[A/T]
CTGATGATGATATCGATGGATCGATCAATGGAGGCGGCTAATATATACTTAACCATTAAGACTCCTCTTAATTACTTAGTACTTAGGAGTAGAAAGAGAG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.20% | 26.60% | 0.21% | 0.02% | NA |
| All Indica | 2759 | 59.80% | 39.90% | 0.33% | 0.04% | NA |
| All Japonica | 1512 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 53.50% | 46.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 44.00% | 55.30% | 0.67% | 0.00% | NA |
| Indica II | 465 | 78.10% | 21.70% | 0.00% | 0.22% | NA |
| Indica III | 913 | 59.00% | 40.90% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 61.70% | 37.80% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 16.70% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0800185506 | T -> A | LOC_Os08g01280.1 | upstream_gene_variant ; 205.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800185506 | T -> A | LOC_Os08g01290.1 | upstream_gene_variant ; 1438.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800185506 | T -> A | LOC_Os08g01290.6 | upstream_gene_variant ; 1438.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800185506 | T -> A | LOC_Os08g01290.7 | upstream_gene_variant ; 1438.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800185506 | T -> A | LOC_Os08g01290.4 | upstream_gene_variant ; 1605.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800185506 | T -> A | LOC_Os08g01290.3 | upstream_gene_variant ; 1608.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800185506 | T -> A | LOC_Os08g01290.2 | upstream_gene_variant ; 2177.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800185506 | T -> A | LOC_Os08g01290.5 | upstream_gene_variant ; 2751.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800185506 | T -> A | LOC_Os08g01274.1 | downstream_gene_variant ; 2960.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800185506 | T -> A | LOC_Os08g01280-LOC_Os08g01290 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800185506 | T -> DEL | N | N | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0800185506 | NA | 1.19E-08 | mr1275 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800185506 | 6.99E-10 | NA | mr1277 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800185506 | 8.40E-10 | 4.60E-09 | mr1277 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800185506 | NA | 6.07E-06 | mr1511 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800185506 | 5.43E-06 | 4.00E-06 | mr1724 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800185506 | 9.57E-17 | 6.32E-12 | mr1746 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800185506 | 9.75E-16 | 5.34E-20 | mr1746 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800185506 | 1.58E-06 | 1.57E-06 | mr1954 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800185506 | 3.40E-08 | NA | mr1277_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800185506 | 2.00E-08 | 6.57E-07 | mr1277_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800185506 | 9.32E-18 | NA | mr1746_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800185506 | 8.30E-20 | 4.55E-26 | mr1746_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |