\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0800185506:

Variant ID: vg0800185506 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 185506
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.73, A: 0.26, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


CTCTCTTTCTACTCCTAAGTACTAAGTAATTAAGAGGAGTCTTAATGGTTAAGTATATATTAGCCGCCTCCATTGATCGATCCATCGATATCATCATCAG[T/A]
GTGAGGACGTCCCGTCCCGTCCGTCGTCCTCCCCGCTAGCAACAATGCAAAAGCTGCAGATCCATCCATCCATCGATACACACCATGCATTAATCAAATC

Reverse complement sequence

GATTTGATTAATGCATGGTGTGTATCGATGGATGGATGGATCTGCAGCTTTTGCATTGTTGCTAGCGGGGAGGACGACGGACGGGACGGGACGTCCTCAC[A/T]
CTGATGATGATATCGATGGATCGATCAATGGAGGCGGCTAATATATACTTAACCATTAAGACTCCTCTTAATTACTTAGTACTTAGGAGTAGAAAGAGAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.20% 26.60% 0.21% 0.02% NA
All Indica  2759 59.80% 39.90% 0.33% 0.04% NA
All Japonica  1512 99.30% 0.70% 0.00% 0.00% NA
Aus  269 53.50% 46.50% 0.00% 0.00% NA
Indica I  595 44.00% 55.30% 0.67% 0.00% NA
Indica II  465 78.10% 21.70% 0.00% 0.22% NA
Indica III  913 59.00% 40.90% 0.11% 0.00% NA
Indica Intermediate  786 61.70% 37.80% 0.51% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 98.60% 1.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 82.20% 16.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0800185506 T -> A LOC_Os08g01280.1 upstream_gene_variant ; 205.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800185506 T -> A LOC_Os08g01290.1 upstream_gene_variant ; 1438.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800185506 T -> A LOC_Os08g01290.6 upstream_gene_variant ; 1438.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800185506 T -> A LOC_Os08g01290.7 upstream_gene_variant ; 1438.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800185506 T -> A LOC_Os08g01290.4 upstream_gene_variant ; 1605.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800185506 T -> A LOC_Os08g01290.3 upstream_gene_variant ; 1608.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800185506 T -> A LOC_Os08g01290.2 upstream_gene_variant ; 2177.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800185506 T -> A LOC_Os08g01290.5 upstream_gene_variant ; 2751.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800185506 T -> A LOC_Os08g01274.1 downstream_gene_variant ; 2960.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800185506 T -> A LOC_Os08g01280-LOC_Os08g01290 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800185506 T -> DEL N N silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0800185506 NA 1.19E-08 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800185506 6.99E-10 NA mr1277 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800185506 8.40E-10 4.60E-09 mr1277 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800185506 NA 6.07E-06 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800185506 5.43E-06 4.00E-06 mr1724 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800185506 9.57E-17 6.32E-12 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800185506 9.75E-16 5.34E-20 mr1746 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800185506 1.58E-06 1.57E-06 mr1954 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800185506 3.40E-08 NA mr1277_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800185506 2.00E-08 6.57E-07 mr1277_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800185506 9.32E-18 NA mr1746_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800185506 8.30E-20 4.55E-26 mr1746_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251