| Variant ID: vg0800182659 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 182659 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, C: 0.07, others allele: 0.00, population size: 209. )
TTGTCACATTGGAGGTTCTCCTTATTGGTGAGGTGCCCATGTGACAATTAATGTCCTCTGGGTTCATGGCATTACTTTACCAATCTCCTTATTGGTAAAG[T/C]
GGTTCTCTTAAATTGTCACATTCTGGTGAGGTGGAGCTGGGTTTAGGCAGCTCCACAACTCCACTTCAGACCTAACTCCTGAAGCTAAATTTAGAAGTTG
CAACTTCTAAATTTAGCTTCAGGAGTTAGGTCTGAAGTGGAGTTGTGGAGCTGCCTAAACCCAGCTCCACCTCACCAGAATGTGACAATTTAAGAGAACC[A/G]
CTTTACCAATAAGGAGATTGGTAAAGTAATGCCATGAACCCAGAGGACATTAATTGTCACATGGGCACCTCACCAATAAGGAGAACCTCCAATGTGACAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.90% | 38.10% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 50.20% | 49.80% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 87.80% | 12.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 52.40% | 47.20% | 0.37% | 0.00% | NA |
| Indica I | 595 | 67.40% | 32.60% | 0.00% | 0.00% | NA |
| Indica II | 465 | 25.60% | 74.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 49.20% | 50.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 52.80% | 47.20% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 97.30% | 2.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 72.60% | 27.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 89.20% | 10.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 18.80% | 81.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 61.10% | 38.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0800182659 | T -> C | LOC_Os08g01270.1 | upstream_gene_variant ; 3209.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800182659 | T -> C | LOC_Os08g01290.1 | upstream_gene_variant ; 4285.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800182659 | T -> C | LOC_Os08g01270.3 | upstream_gene_variant ; 3209.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800182659 | T -> C | LOC_Os08g01270.2 | upstream_gene_variant ; 3209.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800182659 | T -> C | LOC_Os08g01290.6 | upstream_gene_variant ; 4285.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800182659 | T -> C | LOC_Os08g01290.7 | upstream_gene_variant ; 4285.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800182659 | T -> C | LOC_Os08g01290.4 | upstream_gene_variant ; 4452.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800182659 | T -> C | LOC_Os08g01290.3 | upstream_gene_variant ; 4455.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800182659 | T -> C | LOC_Os08g01274.1 | downstream_gene_variant ; 113.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800182659 | T -> C | LOC_Os08g01280.1 | downstream_gene_variant ; 311.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800182659 | T -> C | LOC_Os08g01274-LOC_Os08g01280 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0800182659 | 7.47E-09 | 1.53E-13 | mr1277 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800182659 | 1.80E-08 | 1.47E-07 | mr1277 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800182659 | 1.75E-21 | 1.68E-45 | mr1746 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800182659 | 1.64E-14 | 1.30E-21 | mr1746 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800182659 | NA | 1.16E-13 | mr1746 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800182659 | NA | 7.62E-13 | mr1769 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800182659 | NA | 9.33E-06 | mr1981 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800182659 | NA | 3.59E-12 | mr1055_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800182659 | 2.03E-07 | NA | mr1277_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800182659 | NA | 1.94E-07 | mr1676_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800182659 | 1.50E-23 | 2.59E-47 | mr1746_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800182659 | 1.24E-17 | 5.98E-25 | mr1746_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800182659 | 3.20E-06 | 1.25E-11 | mr1746_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800182659 | NA | 2.96E-13 | mr1769_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |