\
| Variant ID: vg0800161026 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 161026 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 124. )
GACGAATCTAACGAGGTATATTAATCCATGATTTGCTACAGTGATGCTACAGTAATCATCTGCTAATCATAGATTAGTATACCTCGTTAGATTCGTCTCC[C/T]
AAAATAGCCTAGGGGTTATAGAATTGATTTTGTCAGTAATCTACGTTTAATACTCCTAAATAGCAAGATTCCGGAGGGCTATTTAATAGCCCGAAGGATC
GATCCTTCGGGCTATTAAATAGCCCTCCGGAATCTTGCTATTTAGGAGTATTAAACGTAGATTACTGACAAAATCAATTCTATAACCCCTAGGCTATTTT[G/A]
GGAGACGAATCTAACGAGGTATACTAATCTATGATTAGCAGATGATTACTGTAGCATCACTGTAGCAAATCATGGATTAATATACCTCGTTAGATTCGTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.90% | 24.00% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 67.40% | 32.40% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 48.70% | 50.60% | 0.74% | 0.00% | NA |
| Indica I | 595 | 75.10% | 24.50% | 0.34% | 0.00% | NA |
| Indica II | 465 | 85.20% | 14.60% | 0.22% | 0.00% | NA |
| Indica III | 913 | 50.20% | 49.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 71.10% | 28.80% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 19.80% | 80.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 78.90% | 21.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0800161026 | C -> T | LOC_Os08g01230.1 | upstream_gene_variant ; 4446.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800161026 | C -> T | LOC_Os08g01240.1 | downstream_gene_variant ; 1087.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800161026 | C -> T | LOC_Os08g01250.1 | downstream_gene_variant ; 3131.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800161026 | C -> T | LOC_Os08g01240-LOC_Os08g01250 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0800161026 | NA | 9.40E-06 | mr1049 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800161026 | 5.03E-08 | 1.09E-13 | mr1277 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800161026 | 1.23E-07 | 1.10E-10 | mr1277 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800161026 | 1.31E-06 | 1.31E-06 | mr1420 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800161026 | NA | 4.95E-07 | mr1704 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800161026 | NA | 8.27E-06 | mr1743 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800161026 | 5.81E-12 | 1.23E-22 | mr1746 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800161026 | 4.97E-10 | 1.10E-15 | mr1746 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800161026 | 1.39E-06 | 1.39E-06 | mr1747 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800161026 | 9.47E-06 | 9.47E-06 | mr1811 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800161026 | NA | 1.27E-14 | mr1277_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800161026 | NA | 2.06E-07 | mr1277_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800161026 | NA | 3.99E-06 | mr1403_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800161026 | 1.24E-11 | 7.00E-24 | mr1746_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800161026 | 5.05E-11 | 1.45E-16 | mr1746_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |