\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0800161026:

Variant ID: vg0800161026 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 161026
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:


GACGAATCTAACGAGGTATATTAATCCATGATTTGCTACAGTGATGCTACAGTAATCATCTGCTAATCATAGATTAGTATACCTCGTTAGATTCGTCTCC[C/T]
AAAATAGCCTAGGGGTTATAGAATTGATTTTGTCAGTAATCTACGTTTAATACTCCTAAATAGCAAGATTCCGGAGGGCTATTTAATAGCCCGAAGGATC

Reverse complement sequence

GATCCTTCGGGCTATTAAATAGCCCTCCGGAATCTTGCTATTTAGGAGTATTAAACGTAGATTACTGACAAAATCAATTCTATAACCCCTAGGCTATTTT[G/A]
GGAGACGAATCTAACGAGGTATACTAATCTATGATTAGCAGATGATTACTGTAGCATCACTGTAGCAAATCATGGATTAATATACCTCGTTAGATTCGTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.90% 24.00% 0.13% 0.00% NA
All Indica  2759 67.40% 32.40% 0.14% 0.00% NA
All Japonica  1512 99.60% 0.40% 0.00% 0.00% NA
Aus  269 48.70% 50.60% 0.74% 0.00% NA
Indica I  595 75.10% 24.50% 0.34% 0.00% NA
Indica II  465 85.20% 14.60% 0.22% 0.00% NA
Indica III  913 50.20% 49.80% 0.00% 0.00% NA
Indica Intermediate  786 71.10% 28.80% 0.13% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 19.80% 80.20% 0.00% 0.00% NA
Intermediate  90 78.90% 21.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0800161026 C -> T LOC_Os08g01230.1 upstream_gene_variant ; 4446.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800161026 C -> T LOC_Os08g01240.1 downstream_gene_variant ; 1087.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800161026 C -> T LOC_Os08g01250.1 downstream_gene_variant ; 3131.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800161026 C -> T LOC_Os08g01240-LOC_Os08g01250 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0800161026 NA 9.40E-06 mr1049 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800161026 5.03E-08 1.09E-13 mr1277 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800161026 1.23E-07 1.10E-10 mr1277 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800161026 1.31E-06 1.31E-06 mr1420 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800161026 NA 4.95E-07 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800161026 NA 8.27E-06 mr1743 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800161026 5.81E-12 1.23E-22 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800161026 4.97E-10 1.10E-15 mr1746 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800161026 1.39E-06 1.39E-06 mr1747 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800161026 9.47E-06 9.47E-06 mr1811 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800161026 NA 1.27E-14 mr1277_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800161026 NA 2.06E-07 mr1277_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800161026 NA 3.99E-06 mr1403_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800161026 1.24E-11 7.00E-24 mr1746_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800161026 5.05E-11 1.45E-16 mr1746_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251