\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0800160344:

Variant ID: vg0800160344 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 160344
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.07, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


CTATATTTAATGAAATTAACATTCTCTACTCTGGTCGTAAAAAAAAATATAATACAACACCTTATTAACTACTCCTTTCCTAAAAAAATATTAACTACTC[C/T]
CTCCGTCATATTATATAACAATCTAGTATCAGATACGACATGTCAGTACTACAAACCTGAACACTATGTTGCTATATTTTAGAATGGATGTAAGTTGCTG

Reverse complement sequence

CAGCAACTTACATCCATTCTAAAATATAGCAACATAGTGTTCAGGTTTGTAGTACTGACATGTCGTATCTGATACTAGATTGTTATATAATATGACGGAG[G/A]
GAGTAGTTAATATTTTTTTAGGAAAGGAGTAGTTAATAAGGTGTTGTATTATATTTTTTTTTACGACCAGAGTAGAGAATGTTAATTTCATTAAATATAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.40% 40.50% 0.08% 0.00% NA
All Indica  2759 46.40% 53.50% 0.14% 0.00% NA
All Japonica  1512 87.70% 12.30% 0.00% 0.00% NA
Aus  269 49.10% 50.90% 0.00% 0.00% NA
Indica I  595 67.20% 32.80% 0.00% 0.00% NA
Indica II  465 24.50% 75.50% 0.00% 0.00% NA
Indica III  913 43.60% 56.20% 0.22% 0.00% NA
Indica Intermediate  786 46.70% 53.10% 0.25% 0.00% NA
Temperate Japonica  767 97.30% 2.70% 0.00% 0.00% NA
Tropical Japonica  504 72.40% 27.60% 0.00% 0.00% NA
Japonica Intermediate  241 89.20% 10.80% 0.00% 0.00% NA
VI/Aromatic  96 18.80% 81.20% 0.00% 0.00% NA
Intermediate  90 58.90% 41.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0800160344 C -> T LOC_Os08g01230.1 upstream_gene_variant ; 3764.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800160344 C -> T LOC_Os08g01240.1 downstream_gene_variant ; 405.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800160344 C -> T LOC_Os08g01250.1 downstream_gene_variant ; 3813.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800160344 C -> T LOC_Os08g01240-LOC_Os08g01250 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0800160344 9.97E-12 5.80E-17 mr1277 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800160344 3.13E-13 3.87E-11 mr1277 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800160344 1.29E-22 3.93E-45 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800160344 9.57E-18 6.16E-24 mr1746 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800160344 NA 7.16E-12 mr1746 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800160344 NA 3.47E-06 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800160344 NA 9.48E-12 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800160344 3.50E-08 NA mr1277_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800160344 4.44E-07 6.55E-06 mr1277_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800160344 NA 1.52E-07 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800160344 NA 1.37E-07 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800160344 1.17E-23 1.52E-49 mr1746_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800160344 7.49E-22 4.45E-31 mr1746_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800160344 NA 7.43E-10 mr1746_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251