\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0800145551:

Variant ID: vg0800145551 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 145551
Reference Allele: CAlternative Allele: A,G
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTATTGTTTGCGTATAGTTACGGTTGCGGATTTTCGTCGATCGTGGTTATCTCGAAGATTCGTGAAGCTCCGTGAAGGCCTTGAGCAAGGCAAGTCACC[C/A,G]
TTTGATCAATTGCCCCTATAATTGAAAAGTCATTATTATTTTGTTTGCAACTTGCATGATTAGAATCACACACTTAACTTGCTTGGCCTCGGTTTGCGTG

Reverse complement sequence

CACGCAAACCGAGGCCAAGCAAGTTAAGTGTGTGATTCTAATCATGCAAGTTGCAAACAAAATAATAATGACTTTTCAATTATAGGGGCAATTGATCAAA[G/T,C]
GGTGACTTGCCTTGCTCAAGGCCTTCACGGAGCTTCACGAATCTTCGAGATAACCACGATCGACGAAAATCCGCAACCGTAACTATACGCAAACAATAGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.30% 3.70% 9.78% 3.20% G: 0.02%
All Indica  2759 78.40% 5.80% 15.40% 0.40% G: 0.04%
All Japonica  1512 91.20% 0.10% 0.73% 8.00% NA
Aus  269 92.60% 3.70% 3.72% 0.00% NA
Indica I  595 81.70% 1.80% 16.47% 0.00% NA
Indica II  465 76.30% 8.60% 14.84% 0.22% NA
Indica III  913 78.40% 7.00% 13.58% 0.88% G: 0.11%
Indica Intermediate  786 77.10% 5.60% 17.05% 0.25% NA
Temperate Japonica  767 98.60% 0.10% 0.78% 0.52% NA
Tropical Japonica  504 79.40% 0.00% 0.79% 19.84% NA
Japonica Intermediate  241 92.50% 0.00% 0.41% 7.05% NA
VI/Aromatic  96 65.60% 3.10% 12.50% 18.75% NA
Intermediate  90 91.10% 3.30% 4.44% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0800145551 C -> G LOC_Os08g01200.1 upstream_gene_variant ; 1326.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800145551 C -> G LOC_Os08g01210.1 downstream_gene_variant ; 2338.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800145551 C -> G LOC_Os08g01200-LOC_Os08g01210 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800145551 C -> A LOC_Os08g01200.1 upstream_gene_variant ; 1326.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800145551 C -> A LOC_Os08g01210.1 downstream_gene_variant ; 2338.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800145551 C -> A LOC_Os08g01200-LOC_Os08g01210 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800145551 C -> DEL N N silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0800145551 NA 9.64E-13 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800145551 NA 2.78E-06 mr1746 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800145551 NA 1.21E-10 mr1751 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800145551 NA 3.86E-07 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800145551 1.17E-06 NA mr1896 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800145551 NA 4.21E-06 mr1403_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800145551 6.05E-06 2.45E-08 mr1746_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251