\
| Variant ID: vg0800145551 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 145551 |
| Reference Allele: C | Alternative Allele: A,G |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TCTATTGTTTGCGTATAGTTACGGTTGCGGATTTTCGTCGATCGTGGTTATCTCGAAGATTCGTGAAGCTCCGTGAAGGCCTTGAGCAAGGCAAGTCACC[C/A,G]
TTTGATCAATTGCCCCTATAATTGAAAAGTCATTATTATTTTGTTTGCAACTTGCATGATTAGAATCACACACTTAACTTGCTTGGCCTCGGTTTGCGTG
CACGCAAACCGAGGCCAAGCAAGTTAAGTGTGTGATTCTAATCATGCAAGTTGCAAACAAAATAATAATGACTTTTCAATTATAGGGGCAATTGATCAAA[G/T,C]
GGTGACTTGCCTTGCTCAAGGCCTTCACGGAGCTTCACGAATCTTCGAGATAACCACGATCGACGAAAATCCGCAACCGTAACTATACGCAAACAATAGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.30% | 3.70% | 9.78% | 3.20% | G: 0.02% |
| All Indica | 2759 | 78.40% | 5.80% | 15.40% | 0.40% | G: 0.04% |
| All Japonica | 1512 | 91.20% | 0.10% | 0.73% | 8.00% | NA |
| Aus | 269 | 92.60% | 3.70% | 3.72% | 0.00% | NA |
| Indica I | 595 | 81.70% | 1.80% | 16.47% | 0.00% | NA |
| Indica II | 465 | 76.30% | 8.60% | 14.84% | 0.22% | NA |
| Indica III | 913 | 78.40% | 7.00% | 13.58% | 0.88% | G: 0.11% |
| Indica Intermediate | 786 | 77.10% | 5.60% | 17.05% | 0.25% | NA |
| Temperate Japonica | 767 | 98.60% | 0.10% | 0.78% | 0.52% | NA |
| Tropical Japonica | 504 | 79.40% | 0.00% | 0.79% | 19.84% | NA |
| Japonica Intermediate | 241 | 92.50% | 0.00% | 0.41% | 7.05% | NA |
| VI/Aromatic | 96 | 65.60% | 3.10% | 12.50% | 18.75% | NA |
| Intermediate | 90 | 91.10% | 3.30% | 4.44% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0800145551 | C -> G | LOC_Os08g01200.1 | upstream_gene_variant ; 1326.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800145551 | C -> G | LOC_Os08g01210.1 | downstream_gene_variant ; 2338.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800145551 | C -> G | LOC_Os08g01200-LOC_Os08g01210 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800145551 | C -> A | LOC_Os08g01200.1 | upstream_gene_variant ; 1326.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800145551 | C -> A | LOC_Os08g01210.1 | downstream_gene_variant ; 2338.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800145551 | C -> A | LOC_Os08g01200-LOC_Os08g01210 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800145551 | C -> DEL | N | N | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0800145551 | NA | 9.64E-13 | mr1352 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800145551 | NA | 2.78E-06 | mr1746 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800145551 | NA | 1.21E-10 | mr1751 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800145551 | NA | 3.86E-07 | mr1886 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800145551 | 1.17E-06 | NA | mr1896 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800145551 | NA | 4.21E-06 | mr1403_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800145551 | 6.05E-06 | 2.45E-08 | mr1746_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |