\
| Variant ID: vg0800137751 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 137751 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GAGAAGAGCAGTGGGCTACAGGTCTGTAGCCAGTTGTAGCACGGACTCTAAGACGCAACATGTGTATGACAGGTGGGACCATATACTAATAGTATAGTAA[G/A]
CAACTATTGTATAAATTGGCTATTAGATTGGCTATAGATGAATTGAAGCTAGTAGTTGGCTATACTATTAACCTTGCTCTAAGTGCACTACTCTAGTGCT
AGCACTAGAGTAGTGCACTTAGAGCAAGGTTAATAGTATAGCCAACTACTAGCTTCAATTCATCTATAGCCAATCTAATAGCCAATTTATACAATAGTTG[C/T]
TTACTATACTATTAGTATATGGTCCCACCTGTCATACACATGTTGCGTCTTAGAGTCCGTGCTACAACTGGCTACAGACCTGTAGCCCACTGCTCTTCTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.30% | 5.70% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 95.10% | 4.90% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 53.90% | 45.70% | 0.37% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 92.80% | 7.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 93.00% | 7.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0800137751 | G -> A | LOC_Os08g01190.1 | upstream_gene_variant ; 496.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800137751 | G -> A | LOC_Os08g01200.1 | downstream_gene_variant ; 4246.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800137751 | G -> A | LOC_Os08g01180-LOC_Os08g01190 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0800137751 | 4.42E-07 | 1.97E-08 | mr1577 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800137751 | NA | 2.29E-06 | mr1654 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800137751 | 8.53E-06 | NA | mr1746 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800137751 | NA | 8.16E-07 | mr1808 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800137751 | NA | 1.45E-06 | mr1815 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |