\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0800137751:

Variant ID: vg0800137751 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 137751
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAGAAGAGCAGTGGGCTACAGGTCTGTAGCCAGTTGTAGCACGGACTCTAAGACGCAACATGTGTATGACAGGTGGGACCATATACTAATAGTATAGTAA[G/A]
CAACTATTGTATAAATTGGCTATTAGATTGGCTATAGATGAATTGAAGCTAGTAGTTGGCTATACTATTAACCTTGCTCTAAGTGCACTACTCTAGTGCT

Reverse complement sequence

AGCACTAGAGTAGTGCACTTAGAGCAAGGTTAATAGTATAGCCAACTACTAGCTTCAATTCATCTATAGCCAATCTAATAGCCAATTTATACAATAGTTG[C/T]
TTACTATACTATTAGTATATGGTCCCACCTGTCATACACATGTTGCGTCTTAGAGTCCGTGCTACAACTGGCTACAGACCTGTAGCCCACTGCTCTTCTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.30% 5.70% 0.02% 0.00% NA
All Indica  2759 95.10% 4.90% 0.00% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 53.90% 45.70% 0.37% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 97.00% 3.00% 0.00% 0.00% NA
Indica III  913 92.80% 7.20% 0.00% 0.00% NA
Indica Intermediate  786 93.00% 7.00% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0800137751 G -> A LOC_Os08g01190.1 upstream_gene_variant ; 496.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800137751 G -> A LOC_Os08g01200.1 downstream_gene_variant ; 4246.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800137751 G -> A LOC_Os08g01180-LOC_Os08g01190 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0800137751 4.42E-07 1.97E-08 mr1577 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800137751 NA 2.29E-06 mr1654 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800137751 8.53E-06 NA mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800137751 NA 8.16E-07 mr1808 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800137751 NA 1.45E-06 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251