Variant ID: vg0800132787 (JBrowse) | Variation Type: SNP |
Chromosome: chr08 | Position: 132787 |
Reference Allele: G | Alternative Allele: T |
Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, T: 0.01, others allele: 0.00, population size: 222. )
AGATAGATTTCGTATTTCAATATGGATACTTGACTTATTTTGTTTGGTGTGCAAATTAGAATACCAATTTCGTATTTCAATATGGATACTCAATATCAAG[G/T]
TACCAGGTATATACTTAGGATTCTTCTTAATTATCTTAATATTGATATCATCTGCAGCAATTTTAATTGGTCTATTTTGACTTAGATCATCATGACTACA
TGTAGTCATGATGATCTAAGTCAAAATAGACCAATTAAAATTGCTGCAGATGATATCAATATTAAGATAATTAAGAAGAATCCTAAGTATATACCTGGTA[C/A]
CTTGATATTGAGTATCCATATTGAAATACGAAATTGGTATTCTAATTTGCACACCAAACAAAATAAGTCAAGTATCCATATTGAAATACGAAATCTATCT
Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 94.30% | 5.70% | 0.00% | 0.00% | NA |
All Indica | 2759 | 95.00% | 5.00% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Aus | 269 | 54.30% | 45.70% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 96.80% | 3.20% | 0.00% | 0.00% | NA |
Indica III | 913 | 92.80% | 7.20% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0800132787 | G -> T | LOC_Os08g01180-LOC_Os08g01190 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0800132787 | NA | 1.92E-06 | mr1291 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0800132787 | NA | 2.94E-12 | mr1471 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0800132787 | 5.65E-06 | 3.54E-07 | mr1577 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0800132787 | NA | 3.52E-08 | mr1587 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0800132787 | NA | 4.09E-08 | mr1654 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0800132787 | NA | 1.60E-07 | mr1684 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0800132787 | NA | 9.08E-06 | mr1792 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0800132787 | NA | 1.16E-06 | mr1803 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0800132787 | NA | 4.22E-08 | mr1808 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0800132787 | NA | 1.07E-07 | mr1815 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |