\
| Variant ID: vg0800122371 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 122371 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, G: 0.03, others allele: 0.00, population size: 122. )
CTATTTTGAACCGTGATTTTTAGTCTCGGTTCCCATTCGAATTGGGACAAATATGATTTTTGCCATCCAAACAAAGATCAGCTCTCTAGCAGTAACTATT[A/G]
AACGGTACATTTTACATGAAAACTTTTTATACATAAGTTGTTTTAAAAAATCTAATAAATTTATTCATCAAAACTTTATATATTACTACTTAATTAATTA
TAATTAATTAAGTAGTAATATATAAAGTTTTGATGAATAAATTTATTAGATTTTTTAAAACAACTTATGTATAAAAAGTTTTCATGTAAAATGTACCGTT[T/C]
AATAGTTACTGCTAGAGAGCTGATCTTTGTTTGGATGGCAAAAATCATATTTGTCCCAATTCGAATGGGAACCGAGACTAAAAATCACGGTTCAAAATAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.50% | 25.30% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 66.60% | 33.20% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 98.90% | 1.00% | 0.07% | 0.00% | NA |
| Aus | 269 | 13.40% | 86.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 87.40% | 12.60% | 0.00% | 0.00% | NA |
| Indica II | 465 | 30.80% | 69.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 75.60% | 24.00% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 61.60% | 38.20% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.40% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 67.80% | 32.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0800122371 | A -> G | LOC_Os08g01180.1 | upstream_gene_variant ; 1250.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800122371 | A -> G | LOC_Os08g01180-LOC_Os08g01190 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0800122371 | NA | 2.14E-06 | mr1542 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800122371 | NA | 7.24E-06 | mr1564 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800122371 | NA | 5.81E-06 | mr1633 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800122371 | NA | 3.31E-07 | mr1659 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800122371 | 3.36E-07 | NA | mr1746 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800122371 | 7.87E-07 | 8.66E-09 | mr1746 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800122371 | 6.02E-10 | NA | mr1746_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800122371 | 5.23E-09 | 4.14E-11 | mr1746_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |