Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0800104556:

Variant ID: vg0800104556 (JBrowse)	Variation Type: INDEL
Chromosome: chr08	Position: 104556
Reference Allele: CGTTAT	Alternative Allele: TGTTAT,C
Primary Allele: CGTTAT	Secondary Allele: TGTTAT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGTACTCCAATTGTAGGACGTCCTATTTTTAAGAAAAATTAAACTCGGTAACTTTTAACTAATAATCTAACTATGTACTACATATACTAATTATTATGCA[CGTTAT/TGTTAT,C]
ATCACTAGATTCATATTTTAAAGTACTTTCTTGTGATGCTAGTTGCATGTTTGTTGAAAACATAGATTGAAATAAATTAATGGTCAAAGTATGTTATTAA

Reverse complement sequence

TTAATAACATACTTTGACCATTAATTTATTTCAATCTATGTTTTCAACAAACATGCAACTAGCATCACAAGAAAGTACTTTAAAATATGAATCTAGTGAT[ATAACG/ATAACA,G]
TGCATAATAATTAGTATATGTAGTACATAGTTAGATTATTAGTTAAAAGTTACCGAGTTTAATTTTTCTTAAAAATAGGACGTCCTACAATTGGAGTACT

Allele Frequencies:

Populations	Population Size	Frequency of CGTTAT(primary allele)	Frequency of TGTTAT(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.80%	14.60%	0.02%	0.00%	C: 6.50%
All Indica	2759	75.60%	17.80%	0.00%	0.00%	C: 6.56%
All Japonica	1512	87.90%	12.00%	0.07%	0.00%	NA
Aus	269	57.20%	0.00%	0.00%	0.00%	C: 42.75%
Indica I	595	91.90%	8.10%	0.00%	0.00%	NA
Indica II	465	36.60%	59.80%	0.00%	0.00%	C: 3.66%
Indica III	913	90.30%	0.90%	0.00%	0.00%	C: 8.87%
Indica Intermediate	786	69.50%	20.00%	0.00%	0.00%	C: 10.56%
Temperate Japonica	767	97.50%	2.50%	0.00%	0.00%	NA
Tropical Japonica	504	72.20%	27.60%	0.20%	0.00%	NA
Japonica Intermediate	241	90.00%	10.00%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	1.00%	0.00%	0.00%	C: 1.04%
Intermediate	90	68.90%	20.00%	0.00%	0.00%	C: 11.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0800104556	CGTTAT -> C	LOC_Os08g01160.1	upstream_gene_variant ; 3890.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800104556	CGTTAT -> C	LOC_Os08g01170.1	downstream_gene_variant ; 4936.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800104556	CGTTAT -> C	LOC_Os08g01150.1	intron_variant ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800104556	CGTTAT -> TGTTAT	LOC_Os08g01160.1	upstream_gene_variant ; 3891.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800104556	CGTTAT -> TGTTAT	LOC_Os08g01170.1	downstream_gene_variant ; 4937.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800104556	CGTTAT -> TGTTAT	LOC_Os08g01150.1	intron_variant ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0800104556	4.81E-08	NA	mr1138	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800104556	5.00E-06	NA	mr1138	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800104556	NA	2.25E-06	mr1564	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800104556	NA	3.47E-06	mr1564	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800104556	NA	2.30E-10	mr1746	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800104556	NA	1.23E-08	mr1327_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800104556	NA	1.79E-07	mr1632_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800104556	NA	5.21E-08	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800104556	NA	2.29E-11	mr1746_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251