\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0800076023:

Variant ID: vg0800076023 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 76023
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATAAAATAAAATCTTAAATTATAAAAGGAAAGGAGAGTCAAAGTAGGAATACAATTTAAAAATAGCTGAAATTCGAAATTAAAAATAAGGAATATTAAA[T/A]
GAAGAGTTCATATAAGAACCAAATACGAAATTAATTAAAATTCTAAATAAAGGTAAAAATAAATCCGAAATTAGCAAAAGAAAATAAAATAAGAGTTCAA

Reverse complement sequence

TTGAACTCTTATTTTATTTTCTTTTGCTAATTTCGGATTTATTTTTACCTTTATTTAGAATTTTAATTAATTTCGTATTTGGTTCTTATATGAACTCTTC[A/T]
TTTAATATTCCTTATTTTTAATTTCGAATTTCAGCTATTTTTAAATTGTATTCCTACTTTGACTCTCCTTTCCTTTTATAATTTAAGATTTTATTTTATT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.70% 9.70% 3.39% 0.15% NA
All Indica  2759 99.10% 0.20% 0.43% 0.25% NA
All Japonica  1512 61.20% 29.20% 9.59% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.70% 0.00% 0.34% 0.00% NA
Indica II  465 97.40% 0.40% 0.86% 1.29% NA
Indica III  913 99.80% 0.00% 0.11% 0.11% NA
Indica Intermediate  786 99.00% 0.40% 0.64% 0.00% NA
Temperate Japonica  767 36.90% 48.90% 14.21% 0.00% NA
Tropical Japonica  504 94.00% 3.40% 2.58% 0.00% NA
Japonica Intermediate  241 69.70% 20.70% 9.54% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 82.20% 14.40% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0800076023 T -> A LOC_Os08g01100.1 upstream_gene_variant ; 3308.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800076023 T -> A LOC_Os08g01110.1 upstream_gene_variant ; 2175.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800076023 T -> A LOC_Os08g01100-LOC_Os08g01110 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800076023 T -> DEL N N silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0800076023 NA 1.03E-07 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800076023 NA 1.16E-07 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800076023 9.28E-07 NA mr1768_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800076023 NA 9.45E-06 mr1768_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800076023 4.65E-06 NA mr1770_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800076023 NA 1.12E-07 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800076023 NA 1.18E-07 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251