\
| Variant ID: vg0800076023 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 76023 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AATAAAATAAAATCTTAAATTATAAAAGGAAAGGAGAGTCAAAGTAGGAATACAATTTAAAAATAGCTGAAATTCGAAATTAAAAATAAGGAATATTAAA[T/A]
GAAGAGTTCATATAAGAACCAAATACGAAATTAATTAAAATTCTAAATAAAGGTAAAAATAAATCCGAAATTAGCAAAAGAAAATAAAATAAGAGTTCAA
TTGAACTCTTATTTTATTTTCTTTTGCTAATTTCGGATTTATTTTTACCTTTATTTAGAATTTTAATTAATTTCGTATTTGGTTCTTATATGAACTCTTC[A/T]
TTTAATATTCCTTATTTTTAATTTCGAATTTCAGCTATTTTTAAATTGTATTCCTACTTTGACTCTCCTTTCCTTTTATAATTTAAGATTTTATTTTATT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.70% | 9.70% | 3.39% | 0.15% | NA |
| All Indica | 2759 | 99.10% | 0.20% | 0.43% | 0.25% | NA |
| All Japonica | 1512 | 61.20% | 29.20% | 9.59% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.00% | 0.34% | 0.00% | NA |
| Indica II | 465 | 97.40% | 0.40% | 0.86% | 1.29% | NA |
| Indica III | 913 | 99.80% | 0.00% | 0.11% | 0.11% | NA |
| Indica Intermediate | 786 | 99.00% | 0.40% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 36.90% | 48.90% | 14.21% | 0.00% | NA |
| Tropical Japonica | 504 | 94.00% | 3.40% | 2.58% | 0.00% | NA |
| Japonica Intermediate | 241 | 69.70% | 20.70% | 9.54% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 14.40% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0800076023 | T -> A | LOC_Os08g01100.1 | upstream_gene_variant ; 3308.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800076023 | T -> A | LOC_Os08g01110.1 | upstream_gene_variant ; 2175.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800076023 | T -> A | LOC_Os08g01100-LOC_Os08g01110 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800076023 | T -> DEL | N | N | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0800076023 | NA | 1.03E-07 | mr1568_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800076023 | NA | 1.16E-07 | mr1748_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800076023 | 9.28E-07 | NA | mr1768_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800076023 | NA | 9.45E-06 | mr1768_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800076023 | 4.65E-06 | NA | mr1770_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800076023 | NA | 1.12E-07 | mr1910_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800076023 | NA | 1.18E-07 | mr1977_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |