Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0800035751:

Variant ID: vg0800035751 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 35751
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, T: 0.05, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

TTGAGCCTAATTACGCCATGATTTGATAATGTGGTGCTACAGTAAACATTTGCTAATAACGGATTAATTAGGCTTAGTAGATTCGTCTCGCAGTTTACAG[A/T]
TGGAATCTGTAATTTGTTTTGTTATTAGTCTACATTTAATACTTCAAATGTGTGTACATATATGTCTTCAAATGTGTGTACATATATGTCAGTTTTTTTT

Reverse complement sequence

AAAAAAAACTGACATATATGTACACACATTTGAAGACATATATGTACACACATTTGAAGTATTAAATGTAGACTAATAACAAAACAAATTACAGATTCCA[T/A]
CTGTAAACTGCGAGACGAATCTACTAAGCCTAATTAATCCGTTATTAGCAAATGTTTACTGTAGCACCACATTATCAAATCATGGCGTAATTAGGCTCAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.60%	36.10%	1.18%	1.18%	NA
All Indica	2759	46.00%	50.10%	1.99%	1.92%	NA
All Japonica	1512	87.80%	12.00%	0.00%	0.13%	NA
Aus	269	61.30%	38.70%	0.00%	0.00%	NA
Indica I	595	65.90%	28.40%	4.54%	1.18%	NA
Indica II	465	25.40%	70.30%	1.08%	3.23%	NA
Indica III	913	45.00%	52.40%	0.55%	2.08%	NA
Indica Intermediate	786	44.30%	51.90%	2.29%	1.53%	NA
Temperate Japonica	767	97.30%	2.50%	0.00%	0.26%	NA
Tropical Japonica	504	72.40%	27.60%	0.00%	0.00%	NA
Japonica Intermediate	241	90.00%	10.00%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	61.10%	36.70%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0800035751	A -> T	LOC_Os08g01040.1	upstream_gene_variant ; 2233.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800035751	A -> T	LOC_Os08g01054.1	upstream_gene_variant ; 279.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800035751	A -> T	LOC_Os08g01054.2	upstream_gene_variant ; 279.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800035751	A -> T	LOC_Os08g01040-LOC_Os08g01054	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800035751	A -> DEL	N	N	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0800035751	6.08E-13	7.20E-18	mr1277	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800035751	4.65E-12	2.96E-10	mr1277	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800035751	NA	8.71E-06	mr1738	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800035751	1.31E-19	4.40E-34	mr1746	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800035751	4.05E-15	5.10E-20	mr1746	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800035751	NA	1.86E-11	mr1746	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800035751	NA	1.46E-09	mr1019_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800035751	NA	1.28E-13	mr1055_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800035751	1.18E-07	NA	mr1277_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800035751	1.36E-06	NA	mr1277_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800035751	NA	4.65E-07	mr1401_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800035751	NA	2.47E-07	mr1632_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800035751	NA	1.97E-07	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800035751	4.25E-22	8.70E-43	mr1746_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800035751	1.68E-17	2.49E-26	mr1746_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800035751	NA	1.43E-09	mr1746_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251