\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0800035751:

Variant ID: vg0800035751 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 35751
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, T: 0.05, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


TTGAGCCTAATTACGCCATGATTTGATAATGTGGTGCTACAGTAAACATTTGCTAATAACGGATTAATTAGGCTTAGTAGATTCGTCTCGCAGTTTACAG[A/T]
TGGAATCTGTAATTTGTTTTGTTATTAGTCTACATTTAATACTTCAAATGTGTGTACATATATGTCTTCAAATGTGTGTACATATATGTCAGTTTTTTTT

Reverse complement sequence

AAAAAAAACTGACATATATGTACACACATTTGAAGACATATATGTACACACATTTGAAGTATTAAATGTAGACTAATAACAAAACAAATTACAGATTCCA[T/A]
CTGTAAACTGCGAGACGAATCTACTAAGCCTAATTAATCCGTTATTAGCAAATGTTTACTGTAGCACCACATTATCAAATCATGGCGTAATTAGGCTCAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.60% 36.10% 1.18% 1.18% NA
All Indica  2759 46.00% 50.10% 1.99% 1.92% NA
All Japonica  1512 87.80% 12.00% 0.00% 0.13% NA
Aus  269 61.30% 38.70% 0.00% 0.00% NA
Indica I  595 65.90% 28.40% 4.54% 1.18% NA
Indica II  465 25.40% 70.30% 1.08% 3.23% NA
Indica III  913 45.00% 52.40% 0.55% 2.08% NA
Indica Intermediate  786 44.30% 51.90% 2.29% 1.53% NA
Temperate Japonica  767 97.30% 2.50% 0.00% 0.26% NA
Tropical Japonica  504 72.40% 27.60% 0.00% 0.00% NA
Japonica Intermediate  241 90.00% 10.00% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 61.10% 36.70% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0800035751 A -> T LOC_Os08g01040.1 upstream_gene_variant ; 2233.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800035751 A -> T LOC_Os08g01054.1 upstream_gene_variant ; 279.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800035751 A -> T LOC_Os08g01054.2 upstream_gene_variant ; 279.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800035751 A -> T LOC_Os08g01040-LOC_Os08g01054 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800035751 A -> DEL N N silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0800035751 6.08E-13 7.20E-18 mr1277 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800035751 4.65E-12 2.96E-10 mr1277 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800035751 NA 8.71E-06 mr1738 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800035751 1.31E-19 4.40E-34 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800035751 4.05E-15 5.10E-20 mr1746 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800035751 NA 1.86E-11 mr1746 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800035751 NA 1.46E-09 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800035751 NA 1.28E-13 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800035751 1.18E-07 NA mr1277_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800035751 1.36E-06 NA mr1277_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800035751 NA 4.65E-07 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800035751 NA 2.47E-07 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800035751 NA 1.97E-07 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800035751 4.25E-22 8.70E-43 mr1746_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800035751 1.68E-17 2.49E-26 mr1746_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800035751 NA 1.43E-09 mr1746_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251