\
| Variant ID: vg0800007834 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 7834 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GTGCGAGAGATTGCTACGTACTGGTTCGAGAACCAGCGAGCGAGTAGAATTATCTCGAGAACACCAATGGGAGTTGCGGTGCGAGAGATTGCTACGTACT[G/A]
GTTTGAGAACCAGCGAGCGAGTAGAATTATCTCTCAAACACCAATGGAGGCGCTAGAGTTGGTTTATTACATGTGCATCTCATGTGGCCAGCATGACTCA
TGAGTCATGCTGGCCACATGAGATGCACATGTAATAAACCAACTCTAGCGCCTCCATTGGTGTTTGAGAGATAATTCTACTCGCTCGCTGGTTCTCAAAC[C/T]
AGTACGTAGCAATCTCTCGCACCGCAACTCCCATTGGTGTTCTCGAGATAATTCTACTCGCTCGCTGGTTCTCGAACCAGTACGTAGCAATCTCTCGCAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.00% | 1.20% | 4.04% | 13.73% | NA |
| All Indica | 2759 | 78.00% | 1.40% | 4.17% | 16.46% | NA |
| All Japonica | 1512 | 89.20% | 0.10% | 0.40% | 10.32% | NA |
| Aus | 269 | 62.50% | 5.90% | 23.05% | 8.55% | NA |
| Indica I | 595 | 92.10% | 0.00% | 0.00% | 7.90% | NA |
| Indica II | 465 | 45.60% | 0.20% | 3.44% | 50.75% | NA |
| Indica III | 913 | 90.30% | 1.80% | 5.37% | 2.63% | NA |
| Indica Intermediate | 786 | 72.10% | 2.80% | 6.36% | 18.70% | NA |
| Temperate Japonica | 767 | 98.00% | 0.00% | 0.00% | 1.96% | NA |
| Tropical Japonica | 504 | 75.40% | 0.20% | 1.19% | 23.21% | NA |
| Japonica Intermediate | 241 | 90.00% | 0.00% | 0.00% | 9.96% | NA |
| VI/Aromatic | 96 | 97.90% | 0.00% | 1.04% | 1.04% | NA |
| Intermediate | 90 | 74.40% | 1.10% | 7.78% | 16.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0800007834 | G -> A | LOC_Os08g01010.1 | splice_region_variant&intron_variant ; LOW | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800007834 | G -> A | LOC_Os08g01020.1 | upstream_gene_variant ; 2352.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800007834 | G -> A | LOC_Os08g01008.1 | downstream_gene_variant ; 2898.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800007834 | G -> DEL | N | N | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0800007834 | NA | 1.66E-06 | mr1291 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800007834 | 2.89E-06 | 3.91E-13 | mr1471 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800007834 | NA | 2.98E-07 | mr1577 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800007834 | NA | 8.14E-06 | mr1654 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800007834 | NA | 1.22E-06 | mr1684 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800007834 | NA | 2.44E-07 | mr1808 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800007834 | NA | 1.52E-08 | mr1815 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800007834 | NA | 7.07E-08 | mr1808_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |