\
| Variant ID: vg0800005009 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 5009 |
| Reference Allele: G | Alternative Allele: A,C |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, A: 0.08, others allele: 0.00, population size: 241. )
TTTCCCTCGGCAATGGCATACAAATTAGCCGAAGCGTTGTGGTCTTATCGGATGGCATGTCATGGATCAATTCAAGTTCCTCCTTATAAGCTTGTTTATG[G/A,C]
ACATGAAGCAGTTTTACCATGGGAAAATGTCATCGGCTCAAGGAGAATAGATTTACAAGATAAATTGACAGCCGGTGAATATTACAATCTTATGGTGGAT
ATCCACCATAAGATTGTAATATTCACCGGCTGTCAATTTATCTTGTAAATCTATTCTCCTTGAGCCGATGACATTTTCCCATGGTAAAACTGCTTCATGT[C/T,G]
CATAAACAAGCTTATAAGGAGGAACTTGAATTGATCCATGACATGCCATCCGATAAGACCACAACGCTTCGGCTAATTTGTATGCCATTGCCGAGGGAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.80% | 17.00% | 1.80% | 7.45% | NA |
| All Indica | 2759 | 64.00% | 26.00% | 1.92% | 8.12% | NA |
| All Japonica | 1512 | 92.10% | 0.50% | 1.85% | 5.49% | NA |
| Aus | 269 | 61.30% | 22.30% | 1.12% | 15.24% | NA |
| Indica I | 595 | 74.60% | 20.80% | 0.67% | 3.87% | NA |
| Indica II | 465 | 84.90% | 9.00% | 0.86% | 5.16% | NA |
| Indica III | 913 | 46.00% | 37.80% | 3.40% | 12.81% | NA |
| Indica Intermediate | 786 | 64.40% | 26.20% | 1.78% | 7.63% | NA |
| Temperate Japonica | 767 | 99.10% | 0.30% | 0.13% | 0.52% | NA |
| Tropical Japonica | 504 | 80.60% | 1.20% | 4.76% | 13.49% | NA |
| Japonica Intermediate | 241 | 94.20% | 0.00% | 1.24% | 4.56% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 16.70% | 1.11% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0800005009 | G -> C | LOC_Os08g01008.1 | downstream_gene_variant ; 73.0bp to feature; MODIFIER | N | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800005009 | G -> C | LOC_Os08g01010.1 | downstream_gene_variant ; 1554.0bp to feature; MODIFIER | N | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800005009 | G -> C | LOC_Os08g01008-LOC_Os08g01010 | intergenic_region ; MODIFIER | N | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800005009 | G -> A | LOC_Os08g01008.1 | downstream_gene_variant ; 73.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800005009 | G -> A | LOC_Os08g01010.1 | downstream_gene_variant ; 1554.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800005009 | G -> A | LOC_Os08g01008-LOC_Os08g01010 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800005009 | G -> DEL | N | N | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0800005009 | NA | 4.94E-07 | mr1193 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800005009 | 1.99E-11 | 7.43E-20 | mr1277 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800005009 | 2.99E-10 | 1.18E-12 | mr1277 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800005009 | NA | 3.86E-06 | mr1352 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800005009 | NA | 4.81E-06 | mr1654 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800005009 | 1.98E-14 | 1.45E-22 | mr1746 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800005009 | 4.19E-13 | 2.70E-16 | mr1746 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800005009 | 1.90E-06 | NA | mr1811 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800005009 | 2.21E-06 | 2.21E-06 | mr1811 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800005009 | 9.81E-07 | 4.00E-16 | mr1277_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800005009 | 1.42E-06 | 2.53E-09 | mr1277_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800005009 | NA | 2.61E-06 | mr1403_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800005009 | 4.36E-15 | 4.49E-30 | mr1746_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800005009 | 4.18E-13 | 7.31E-20 | mr1746_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |