\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0800005009:

Variant ID: vg0800005009 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 5009
Reference Allele: GAlternative Allele: A,C
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, A: 0.08, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


TTTCCCTCGGCAATGGCATACAAATTAGCCGAAGCGTTGTGGTCTTATCGGATGGCATGTCATGGATCAATTCAAGTTCCTCCTTATAAGCTTGTTTATG[G/A,C]
ACATGAAGCAGTTTTACCATGGGAAAATGTCATCGGCTCAAGGAGAATAGATTTACAAGATAAATTGACAGCCGGTGAATATTACAATCTTATGGTGGAT

Reverse complement sequence

ATCCACCATAAGATTGTAATATTCACCGGCTGTCAATTTATCTTGTAAATCTATTCTCCTTGAGCCGATGACATTTTCCCATGGTAAAACTGCTTCATGT[C/T,G]
CATAAACAAGCTTATAAGGAGGAACTTGAATTGATCCATGACATGCCATCCGATAAGACCACAACGCTTCGGCTAATTTGTATGCCATTGCCGAGGGAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.80% 17.00% 1.80% 7.45% NA
All Indica  2759 64.00% 26.00% 1.92% 8.12% NA
All Japonica  1512 92.10% 0.50% 1.85% 5.49% NA
Aus  269 61.30% 22.30% 1.12% 15.24% NA
Indica I  595 74.60% 20.80% 0.67% 3.87% NA
Indica II  465 84.90% 9.00% 0.86% 5.16% NA
Indica III  913 46.00% 37.80% 3.40% 12.81% NA
Indica Intermediate  786 64.40% 26.20% 1.78% 7.63% NA
Temperate Japonica  767 99.10% 0.30% 0.13% 0.52% NA
Tropical Japonica  504 80.60% 1.20% 4.76% 13.49% NA
Japonica Intermediate  241 94.20% 0.00% 1.24% 4.56% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 77.80% 16.70% 1.11% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0800005009 G -> C LOC_Os08g01008.1 downstream_gene_variant ; 73.0bp to feature; MODIFIER N Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800005009 G -> C LOC_Os08g01010.1 downstream_gene_variant ; 1554.0bp to feature; MODIFIER N Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800005009 G -> C LOC_Os08g01008-LOC_Os08g01010 intergenic_region ; MODIFIER N Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800005009 G -> A LOC_Os08g01008.1 downstream_gene_variant ; 73.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800005009 G -> A LOC_Os08g01010.1 downstream_gene_variant ; 1554.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800005009 G -> A LOC_Os08g01008-LOC_Os08g01010 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800005009 G -> DEL N N silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0800005009 NA 4.94E-07 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800005009 1.99E-11 7.43E-20 mr1277 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800005009 2.99E-10 1.18E-12 mr1277 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800005009 NA 3.86E-06 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800005009 NA 4.81E-06 mr1654 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800005009 1.98E-14 1.45E-22 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800005009 4.19E-13 2.70E-16 mr1746 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800005009 1.90E-06 NA mr1811 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800005009 2.21E-06 2.21E-06 mr1811 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800005009 9.81E-07 4.00E-16 mr1277_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800005009 1.42E-06 2.53E-09 mr1277_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800005009 NA 2.61E-06 mr1403_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800005009 4.36E-15 4.49E-30 mr1746_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800005009 4.18E-13 7.31E-20 mr1746_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251