| Variant ID: vg0800003353 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 3353 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 263. )
TAATGTGTTTGGCACGTCATGGATTGCGGGTAAAGCGTACATCTACTGCAGTATGAATATCCTCAAAACTATTCGAATAGCCATGCTCGCGGTTATCGGG[C/T]
ATCGGGACTCACTATGGCATCTTGGATAGAAACCTAACTTAAAACTTTACTAAATACTGTTGCATTTAAAACATTATAGGCTTTCTTCCTCTATATTATC
GATAATATAGAGGAAGAAAGCCTATAATGTTTTAAATGCAACAGTATTTAGTAAAGTTTTAAGTTAGGTTTCTATCCAAGATGCCATAGTGAGTCCCGAT[G/A]
CCCGATAACCGCGAGCATGGCTATTCGAATAGTTTTGAGGATATTCATACTGCAGTAGATGTACGCTTTACCCGCAATCCATGACGTGCCAAACACATTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.30% | 12.70% | 4.27% | 3.72% | NA |
| All Indica | 2759 | 76.00% | 16.80% | 6.34% | 0.91% | NA |
| All Japonica | 1512 | 88.60% | 0.70% | 0.73% | 9.92% | NA |
| Aus | 269 | 58.00% | 38.30% | 3.72% | 0.00% | NA |
| Indica I | 595 | 91.90% | 4.50% | 3.03% | 0.50% | NA |
| Indica II | 465 | 37.40% | 39.40% | 20.43% | 2.80% | NA |
| Indica III | 913 | 89.90% | 9.40% | 0.55% | 0.11% | NA |
| Indica Intermediate | 786 | 70.50% | 21.20% | 7.25% | 1.02% | NA |
| Temperate Japonica | 767 | 97.80% | 0.50% | 0.26% | 1.43% | NA |
| Tropical Japonica | 504 | 73.80% | 1.00% | 1.79% | 23.41% | NA |
| Japonica Intermediate | 241 | 90.50% | 0.80% | 0.00% | 8.71% | NA |
| VI/Aromatic | 96 | 97.90% | 1.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 71.10% | 22.20% | 6.67% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0800003353 | C -> T | LOC_Os08g01008.1 | upstream_gene_variant ; 780.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800003353 | C -> T | LOC_Os08g01010.1 | downstream_gene_variant ; 3210.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800003353 | C -> T | LOC_Os08g01008 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800003353 | C -> DEL | N | N | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0800003353 | NA | 2.08E-07 | mr1291 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800003353 | NA | 7.27E-12 | mr1471 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800003353 | NA | 7.38E-08 | mr1577 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800003353 | NA | 3.50E-06 | mr1654 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800003353 | NA | 2.38E-07 | mr1808 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800003353 | NA | 1.30E-09 | mr1815 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800003353 | NA | 4.58E-07 | mr1808_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |