Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0729692653:

Variant ID: vg0729692653 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 29692653
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAGGTGGTGAACTCCAAACCACTCACAAACGGTGCCGGGCCTCCTCCACAATCTCCTCGGAGAGGTCAACGGGCAACACCTCCACAAGCCGTATAGGAGG[T/C]
GGCAACCTCTAAGAGTAACAAGTCTAGGATGCTTGCCGAGGATGATCAAGTGCCACACTAGCTATAACAATGAAGCAATGCACTTCGATTGGCTTAACTC

Reverse complement sequence

GAGTTAAGCCAATCGAAGTGCATTGCTTCATTGTTATAGCTAGTGTGGCACTTGATCATCCTCGGCAAGCATCCTAGACTTGTTACTCTTAGAGGTTGCC[A/G]
CCTCCTATACGGCTTGTGGAGGTGTTGCCCGTTGACCTCTCCGAGGAGATTGTGGAGGAGGCCCGGCACCGTTTGTGAGTGGTTTGGAGTTCACCACCTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	21.60%	0.10%	0.21%	78.04%	NA
All Indica	2759	1.40%	0.10%	0.25%	98.26%	NA
All Japonica	1512	60.60%	0.10%	0.07%	39.22%	NA
Aus	269	10.80%	0.00%	0.00%	89.22%	NA
Indica I	595	0.80%	0.00%	0.67%	98.49%	NA
Indica II	465	2.20%	0.00%	0.22%	97.63%	NA
Indica III	913	0.30%	0.00%	0.00%	99.67%	NA
Indica Intermediate	786	2.70%	0.30%	0.25%	96.82%	NA
Temperate Japonica	767	93.00%	0.10%	0.00%	6.91%	NA
Tropical Japonica	504	14.70%	0.00%	0.20%	85.12%	NA
Japonica Intermediate	241	53.90%	0.00%	0.00%	46.06%	NA
VI/Aromatic	96	8.30%	0.00%	0.00%	91.67%	NA
Intermediate	90	33.30%	2.20%	2.22%	62.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0729692653	T -> DEL	N	N	silent_mutation	Average:11.432; most accessible tissue: Callus, score: 24.163	N	N	N	N
vg0729692653	T -> C	N	intergenic_region ; MODIFIER	silent_mutation	Average:11.432; most accessible tissue: Callus, score: 24.163	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0729692653	NA	2.89E-06	mr1030	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729692653	NA	1.11E-12	mr1034	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729692653	NA	4.81E-08	mr1045	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729692653	6.74E-06	6.74E-06	mr1048	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729692653	5.95E-06	NA	mr1075	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729692653	NA	3.61E-19	mr1077	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729692653	3.38E-06	8.83E-07	mr1084	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729692653	NA	9.23E-06	mr1147	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729692653	8.03E-06	8.03E-06	mr1196	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729692653	5.97E-06	1.98E-06	mr1206	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729692653	NA	3.18E-06	mr1229	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729692653	2.56E-06	2.56E-06	mr1270	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729692653	3.90E-07	2.03E-07	mr1283	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729692653	NA	5.96E-06	mr1285	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729692653	1.48E-06	1.48E-06	mr1288	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729692653	3.99E-06	NA	mr1296	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729692653	NA	1.92E-06	mr1314	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729692653	5.35E-06	5.35E-06	mr1353	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729692653	4.27E-06	4.27E-06	mr1356	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729692653	6.29E-06	6.29E-06	mr1357	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729692653	2.99E-06	2.99E-06	mr1366	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729692653	5.22E-06	5.22E-06	mr1384	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729692653	NA	1.88E-06	mr1409	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729692653	NA	9.69E-06	mr1426	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729692653	3.92E-06	NA	mr1454	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729692653	2.20E-06	2.20E-06	mr1472	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729692653	2.26E-06	2.26E-06	mr1474	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729692653	2.26E-06	2.26E-06	mr1475	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729692653	1.84E-06	1.84E-06	mr1481	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729692653	NA	2.10E-06	mr1504	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729692653	2.36E-07	1.14E-07	mr1511	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729692653	5.36E-07	5.36E-07	mr1513	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729692653	4.11E-06	4.11E-06	mr1523	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729692653	7.11E-06	7.37E-06	mr1564	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729692653	5.05E-06	NA	mr1571	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729692653	NA	3.04E-06	mr1571	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729692653	NA	7.84E-06	mr1637	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729692653	7.90E-07	1.00E-07	mr1669	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729692653	3.41E-06	2.29E-09	mr1716	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729692653	2.33E-06	2.84E-07	mr1716	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729692653	6.11E-06	6.11E-06	mr1724	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729692653	NA	4.97E-06	mr1895	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729692653	NA	1.84E-07	mr1915	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729692653	NA	2.79E-08	mr1946	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729692653	5.49E-06	5.49E-06	mr1948	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729692653	NA	2.57E-06	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729692653	NA	5.40E-06	mr1083_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729692653	NA	8.98E-06	mr1408_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251