\
| Variant ID: vg0729687346 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 29687346 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
ATAAGTCTTTACGGCAGACTCTTGCCCAAACATATCTCTAAAGAAACTATTTAAAATATCATAATTAATAGATATAATTGCCTATCTGAGAGCCTATCTC[C/A]
ATCGTGACAATCCTTGTGTAGCACGTTAATCGATTCCAGAAACGGTTTCATAACCATCTCAATGAAATCGGCTGTATCGGCTTTATTGGCTGTTTTCTGT
ACAGAAAACAGCCAATAAAGCCGATACAGCCGATTTCATTGAGATGGTTATGAAACCGTTTCTGGAATCGATTAACGTGCTACACAAGGATTGTCACGAT[G/T]
GAGATAGGCTCTCAGATAGGCAATTATATCTATTAATTATGATATTTTAAATAGTTTCTTTAGAGATATGTTTGGGCAAGAGTCTGCCGTAAAGACTTAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.80% | 21.40% | 2.73% | 26.05% | NA |
| All Indica | 2759 | 76.40% | 1.20% | 3.88% | 18.56% | NA |
| All Japonica | 1512 | 2.00% | 60.50% | 0.53% | 36.97% | NA |
| Aus | 269 | 63.60% | 11.20% | 1.86% | 23.42% | NA |
| Indica I | 595 | 52.60% | 0.50% | 6.72% | 40.17% | NA |
| Indica II | 465 | 68.00% | 1.90% | 4.30% | 25.81% | NA |
| Indica III | 913 | 95.80% | 0.10% | 2.19% | 1.86% | NA |
| Indica Intermediate | 786 | 76.80% | 2.40% | 3.44% | 17.30% | NA |
| Temperate Japonica | 767 | 0.10% | 93.10% | 0.13% | 6.65% | NA |
| Tropical Japonica | 504 | 4.00% | 14.50% | 0.99% | 80.56% | NA |
| Japonica Intermediate | 241 | 3.70% | 53.10% | 0.83% | 42.32% | NA |
| VI/Aromatic | 96 | 11.50% | 9.40% | 0.00% | 79.17% | NA |
| Intermediate | 90 | 36.70% | 30.00% | 10.00% | 23.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0729687346 | C -> DEL | N | N | silent_mutation | Average:14.734; most accessible tissue: Minghui63 root, score: 25.504 | N | N | N | N |
| vg0729687346 | C -> A | N | intergenic_region ; MODIFIER | silent_mutation | Average:14.734; most accessible tissue: Minghui63 root, score: 25.504 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0729687346 | NA | 1.07E-10 | mr1316 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729687346 | 1.66E-06 | NA | mr1499 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729687346 | NA | 7.37E-12 | mr1540 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729687346 | NA | 3.92E-11 | mr1712 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729687346 | NA | 2.53E-08 | mr1716 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729687346 | NA | 1.41E-08 | mr1770 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729687346 | NA | 1.17E-09 | mr1790 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729687346 | NA | 2.87E-24 | mr1862 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729687346 | NA | 7.08E-07 | mr1915 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729687346 | NA | 7.25E-09 | mr1946 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729687346 | NA | 3.77E-06 | mr1977 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729687346 | NA | 1.80E-06 | mr1250_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729687346 | NA | 1.49E-07 | mr1446_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |