\
| Variant ID: vg0729677691 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 29677691 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GTCCTATGGTTAATATTCACGTTGTGTCTGACGATCCCAAGGCTAACACTCGTAAAATTTTGGTACTAAGTTGATTGTGTTCTGAACGGGACCAAGGTCA[G/A]
CTGAACTAAAAATATTCATGTGTTTTTTTTTCAATAATAAGGTTCATACTAATGAATTTCTTCTAGCCGAAGGCTAAAAAAAATCACGAAATGTTCTCCT
AGGAGAACATTTCGTGATTTTTTTTAGCCTTCGGCTAGAAGAAATTCATTAGTATGAACCTTATTATTGAAAAAAAAACACATGAATATTTTTAGTTCAG[C/T]
TGACCTTGGTCCCGTTCAGAACACAATCAACTTAGTACCAAAATTTTACGAGTGTTAGCCTTGGGATCGTCAGACACAACGTGAATATTAACCATAGGAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.80% | 0.70% | 1.21% | 48.37% | NA |
| All Indica | 2759 | 29.80% | 0.00% | 0.72% | 69.45% | NA |
| All Japonica | 1512 | 83.40% | 2.10% | 2.25% | 12.30% | NA |
| Aus | 269 | 43.10% | 0.00% | 0.37% | 56.51% | NA |
| Indica I | 595 | 6.60% | 0.00% | 0.84% | 92.61% | NA |
| Indica II | 465 | 14.40% | 0.00% | 0.65% | 84.95% | NA |
| Indica III | 913 | 49.10% | 0.00% | 0.66% | 50.27% | NA |
| Indica Intermediate | 786 | 34.20% | 0.00% | 0.76% | 65.01% | NA |
| Temperate Japonica | 767 | 91.40% | 4.00% | 3.78% | 0.78% | NA |
| Tropical Japonica | 504 | 78.80% | 0.00% | 0.79% | 20.44% | NA |
| Japonica Intermediate | 241 | 67.60% | 0.00% | 0.41% | 31.95% | NA |
| VI/Aromatic | 96 | 95.80% | 0.00% | 0.00% | 4.17% | NA |
| Intermediate | 90 | 66.70% | 0.00% | 2.22% | 31.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0729677691 | G -> DEL | N | N | silent_mutation | Average:12.419; most accessible tissue: Callus, score: 70.126 | N | N | N | N |
| vg0729677691 | G -> A | LOC_Os07g49540.1 | downstream_gene_variant ; 795.0bp to feature; MODIFIER | silent_mutation | Average:12.419; most accessible tissue: Callus, score: 70.126 | N | N | N | N |
| vg0729677691 | G -> A | LOC_Os07g49530-LOC_Os07g49540 | intergenic_region ; MODIFIER | silent_mutation | Average:12.419; most accessible tissue: Callus, score: 70.126 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0729677691 | 7.74E-07 | 9.86E-10 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729677691 | 1.79E-07 | 1.13E-10 | mr1305 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729677691 | NA | 5.46E-06 | mr1515 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729677691 | 1.46E-06 | 1.74E-10 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729677691 | 3.58E-07 | 2.88E-10 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729677691 | NA | 2.42E-07 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729677691 | 3.58E-06 | 2.79E-10 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729677691 | 6.09E-06 | 2.51E-06 | mr1672_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |