\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0729677691:

Variant ID: vg0729677691 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 29677691
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTCCTATGGTTAATATTCACGTTGTGTCTGACGATCCCAAGGCTAACACTCGTAAAATTTTGGTACTAAGTTGATTGTGTTCTGAACGGGACCAAGGTCA[G/A]
CTGAACTAAAAATATTCATGTGTTTTTTTTTCAATAATAAGGTTCATACTAATGAATTTCTTCTAGCCGAAGGCTAAAAAAAATCACGAAATGTTCTCCT

Reverse complement sequence

AGGAGAACATTTCGTGATTTTTTTTAGCCTTCGGCTAGAAGAAATTCATTAGTATGAACCTTATTATTGAAAAAAAAACACATGAATATTTTTAGTTCAG[C/T]
TGACCTTGGTCCCGTTCAGAACACAATCAACTTAGTACCAAAATTTTACGAGTGTTAGCCTTGGGATCGTCAGACACAACGTGAATATTAACCATAGGAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.80% 0.70% 1.21% 48.37% NA
All Indica  2759 29.80% 0.00% 0.72% 69.45% NA
All Japonica  1512 83.40% 2.10% 2.25% 12.30% NA
Aus  269 43.10% 0.00% 0.37% 56.51% NA
Indica I  595 6.60% 0.00% 0.84% 92.61% NA
Indica II  465 14.40% 0.00% 0.65% 84.95% NA
Indica III  913 49.10% 0.00% 0.66% 50.27% NA
Indica Intermediate  786 34.20% 0.00% 0.76% 65.01% NA
Temperate Japonica  767 91.40% 4.00% 3.78% 0.78% NA
Tropical Japonica  504 78.80% 0.00% 0.79% 20.44% NA
Japonica Intermediate  241 67.60% 0.00% 0.41% 31.95% NA
VI/Aromatic  96 95.80% 0.00% 0.00% 4.17% NA
Intermediate  90 66.70% 0.00% 2.22% 31.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0729677691 G -> DEL N N silent_mutation Average:12.419; most accessible tissue: Callus, score: 70.126 N N N N
vg0729677691 G -> A LOC_Os07g49540.1 downstream_gene_variant ; 795.0bp to feature; MODIFIER silent_mutation Average:12.419; most accessible tissue: Callus, score: 70.126 N N N N
vg0729677691 G -> A LOC_Os07g49530-LOC_Os07g49540 intergenic_region ; MODIFIER silent_mutation Average:12.419; most accessible tissue: Callus, score: 70.126 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0729677691 7.74E-07 9.86E-10 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729677691 1.79E-07 1.13E-10 mr1305 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729677691 NA 5.46E-06 mr1515 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729677691 1.46E-06 1.74E-10 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729677691 3.58E-07 2.88E-10 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729677691 NA 2.42E-07 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729677691 3.58E-06 2.79E-10 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729677691 6.09E-06 2.51E-06 mr1672_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251