| Variant ID: vg0729677036 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 29677036 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CAAGGCTAATTCTCGTGAAATTTTGAACTGATGAAAATTATTCATGCCTTTTCTTGCCAAAGGTATTTACTCATGAATTTTGGCAAACAACTGTAACTTA[C/T]
GAAATTACAGCCTAAGGTTAAAAGCCACGGATTTTTTTGTCCTATATGATTAATATTACGAGTTTTGTGCACAACGATCCCAAGGACTATTTGGTTCATG
CATGAACCAAATAGTCCTTGGGATCGTTGTGCACAAAACTCGTAATATTAATCATATAGGACAAAAAAATCCGTGGCTTTTAACCTTAGGCTGTAATTTC[G/A]
TAAGTTACAGTTGTTTGCCAAAATTCATGAGTAAATACCTTTGGCAAGAAAAGGCATGAATAATTTTCATCAGTTCAAAATTTCACGAGAATTAGCCTTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 29.10% | 21.60% | 0.38% | 48.92% | NA |
| All Indica | 2759 | 2.20% | 27.30% | 0.36% | 70.13% | NA |
| All Japonica | 1512 | 81.60% | 5.40% | 0.33% | 12.63% | NA |
| Aus | 269 | 11.90% | 31.20% | 0.37% | 56.51% | NA |
| Indica I | 595 | 2.00% | 4.40% | 0.50% | 93.11% | NA |
| Indica II | 465 | 1.70% | 12.00% | 0.22% | 86.02% | NA |
| Indica III | 913 | 0.20% | 48.00% | 0.33% | 51.48% | NA |
| Indica Intermediate | 786 | 5.00% | 29.60% | 0.38% | 65.01% | NA |
| Temperate Japonica | 767 | 99.00% | 0.10% | 0.00% | 0.91% | NA |
| Tropical Japonica | 504 | 63.50% | 14.70% | 0.60% | 21.23% | NA |
| Japonica Intermediate | 241 | 64.30% | 2.90% | 0.83% | 31.95% | NA |
| VI/Aromatic | 96 | 7.30% | 88.50% | 1.04% | 3.12% | NA |
| Intermediate | 90 | 46.70% | 17.80% | 1.11% | 34.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0729677036 | C -> DEL | N | N | silent_mutation | Average:9.816; most accessible tissue: Callus, score: 53.274 | N | N | N | N |
| vg0729677036 | C -> T | LOC_Os07g49540.1 | downstream_gene_variant ; 1450.0bp to feature; MODIFIER | silent_mutation | Average:9.816; most accessible tissue: Callus, score: 53.274 | N | N | N | N |
| vg0729677036 | C -> T | LOC_Os07g49530-LOC_Os07g49540 | intergenic_region ; MODIFIER | silent_mutation | Average:9.816; most accessible tissue: Callus, score: 53.274 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0729677036 | 2.00E-06 | 4.64E-06 | mr1233 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729677036 | NA | 3.91E-07 | mr1364 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729677036 | NA | 1.96E-07 | mr1414 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729677036 | NA | 2.96E-07 | mr1443 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729677036 | NA | 1.77E-06 | mr1602 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729677036 | NA | 2.00E-09 | mr1696 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |