\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0729650535:

Variant ID: vg0729650535 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 29650535
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:


GATGTCATAGTAGTAGAACCTTGAGCACCAAGTCCCCCTACCTGGCGCGCTACTGTTGACAGGTGATACCCGTAGACCGGATATAGAGGGTATTGGGGTA[C/T]
GCTGGTACAAGGATCTACGTAATACGACATCAAGCGGACAGAAAACGAAAATTATACTGGTTCAGGCCCCTTGATAGGTAATAGCCCTAATCCAGTTGAT

Reverse complement sequence

ATCAACTGGATTAGGGCTATTACCTATCAAGGGGCCTGAACCAGTATAATTTTCGTTTTCTGTCCGCTTGATGTCGTATTACGTAGATCCTTGTACCAGC[G/A]
TACCCCAATACCCTCTATATCCGGTCTACGGGTATCACCTGTCAACAGTAGCGCGCCAGGTAGGGGGACTTGGTGCTCAAGGTTCTACTACTATGACATC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.60% 8.30% 2.18% 0.00% NA
All Indica  2759 82.70% 13.80% 3.52% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 97.00% 1.00% 2.02% 0.00% NA
Indica II  465 47.10% 42.60% 10.32% 0.00% NA
Indica III  913 94.10% 5.40% 0.55% 0.00% NA
Indica Intermediate  786 79.60% 16.30% 4.07% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 87.80% 6.70% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0729650535 C -> T LOC_Os07g49500.1 upstream_gene_variant ; 609.0bp to feature; MODIFIER silent_mutation Average:52.252; most accessible tissue: Minghui63 flag leaf, score: 73.334 N N N N
vg0729650535 C -> T LOC_Os07g49510.1 upstream_gene_variant ; 2603.0bp to feature; MODIFIER silent_mutation Average:52.252; most accessible tissue: Minghui63 flag leaf, score: 73.334 N N N N
vg0729650535 C -> T LOC_Os07g49500-LOC_Os07g49510 intergenic_region ; MODIFIER silent_mutation Average:52.252; most accessible tissue: Minghui63 flag leaf, score: 73.334 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0729650535 NA 4.55E-08 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729650535 NA 1.31E-07 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729650535 NA 3.54E-07 mr1928 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729650535 NA 2.58E-09 mr1319_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729650535 NA 6.08E-10 mr1327_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729650535 NA 5.19E-09 mr1327_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729650535 NA 1.90E-07 mr1330_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729650535 NA 5.42E-11 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729650535 NA 8.62E-06 mr1360_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729650535 NA 5.35E-06 mr1360_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729650535 NA 1.08E-07 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729650535 7.53E-06 6.19E-13 mr1449_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729650535 8.36E-06 7.40E-09 mr1449_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729650535 7.95E-06 7.94E-06 mr1630_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729650535 NA 1.55E-09 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729650535 NA 8.63E-06 mr1733_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729650535 NA 9.84E-06 mr1931_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729650535 NA 7.21E-06 mr1931_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251