Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0729650535:

Variant ID: vg0729650535 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 29650535
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:

GATGTCATAGTAGTAGAACCTTGAGCACCAAGTCCCCCTACCTGGCGCGCTACTGTTGACAGGTGATACCCGTAGACCGGATATAGAGGGTATTGGGGTA[C/T]
GCTGGTACAAGGATCTACGTAATACGACATCAAGCGGACAGAAAACGAAAATTATACTGGTTCAGGCCCCTTGATAGGTAATAGCCCTAATCCAGTTGAT

Reverse complement sequence

ATCAACTGGATTAGGGCTATTACCTATCAAGGGGCCTGAACCAGTATAATTTTCGTTTTCTGTCCGCTTGATGTCGTATTACGTAGATCCTTGTACCAGC[G/A]
TACCCCAATACCCTCTATATCCGGTCTACGGGTATCACCTGTCAACAGTAGCGCGCCAGGTAGGGGGACTTGGTGCTCAAGGTTCTACTACTATGACATC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.60%	8.30%	2.18%	0.00%	NA
All Indica	2759	82.70%	13.80%	3.52%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	99.60%	0.00%	0.37%	0.00%	NA
Indica I	595	97.00%	1.00%	2.02%	0.00%	NA
Indica II	465	47.10%	42.60%	10.32%	0.00%	NA
Indica III	913	94.10%	5.40%	0.55%	0.00%	NA
Indica Intermediate	786	79.60%	16.30%	4.07%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	87.80%	6.70%	5.56%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0729650535	C -> T	LOC_Os07g49500.1	upstream_gene_variant ; 609.0bp to feature; MODIFIER	silent_mutation	Average:52.252; most accessible tissue: Minghui63 flag leaf, score: 73.334	N	N	N	N
vg0729650535	C -> T	LOC_Os07g49510.1	upstream_gene_variant ; 2603.0bp to feature; MODIFIER	silent_mutation	Average:52.252; most accessible tissue: Minghui63 flag leaf, score: 73.334	N	N	N	N
vg0729650535	C -> T	LOC_Os07g49500-LOC_Os07g49510	intergenic_region ; MODIFIER	silent_mutation	Average:52.252; most accessible tissue: Minghui63 flag leaf, score: 73.334	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0729650535	NA	4.55E-08	mr1666	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729650535	NA	1.31E-07	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729650535	NA	3.54E-07	mr1928	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729650535	NA	2.58E-09	mr1319_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729650535	NA	6.08E-10	mr1327_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729650535	NA	5.19E-09	mr1327_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729650535	NA	1.90E-07	mr1330_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729650535	NA	5.42E-11	mr1338_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729650535	NA	8.62E-06	mr1360_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729650535	NA	5.35E-06	mr1360_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729650535	NA	1.08E-07	mr1378_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729650535	7.53E-06	6.19E-13	mr1449_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729650535	8.36E-06	7.40E-09	mr1449_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729650535	7.95E-06	7.94E-06	mr1630_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729650535	NA	1.55E-09	mr1715_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729650535	NA	8.63E-06	mr1733_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729650535	NA	9.84E-06	mr1931_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729650535	NA	7.21E-06	mr1931_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251