Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0729640266:

Variant ID: vg0729640266 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 29640266
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.05, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:

TACGTAATACGACATCAAGCGGACAGAAAACAAAAATTATACTGGTTCAGGCCCCTTGATAGGTAATAGCCCTAATCCAGTTGATATGGGATTATATGAT[A/G]
AAAATCACAGGTTACAAAGGGAATGATGGAACTCGATGATACCGGCGAGATCGTAATCGAGTTGGTTCGACTAGATCTCCCGGCGACTTGGCTCCAGTGG

Reverse complement sequence

CCACTGGAGCCAAGTCGCCGGGAGATCTAGTCGAACCAACTCGATTACGATCTCGCCGGTATCATCGAGTTCCATCATTCCCTTTGTAACCTGTGATTTT[T/C]
ATCATATAATCCCATATCAACTGGATTAGGGCTATTACCTATCAAGGGGCCTGAACCAGTATAATTTTTGTTTTCTGTCCGCTTGATGTCGTATTACGTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.70%	21.20%	0.04%	0.00%	NA
All Indica	2759	99.10%	0.90%	0.00%	0.00%	NA
All Japonica	1512	39.60%	60.40%	0.00%	0.00%	NA
Aus	269	89.20%	10.80%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	98.70%	1.30%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	97.80%	2.20%	0.00%	0.00%	NA
Temperate Japonica	767	6.90%	93.10%	0.00%	0.00%	NA
Tropical Japonica	504	85.70%	14.30%	0.00%	0.00%	NA
Japonica Intermediate	241	46.90%	53.10%	0.00%	0.00%	NA
VI/Aromatic	96	90.60%	9.40%	0.00%	0.00%	NA
Intermediate	90	66.70%	31.10%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0729640266	A -> G	LOC_Os07g49480.1	upstream_gene_variant ; 1903.0bp to feature; MODIFIER	silent_mutation	Average:56.639; most accessible tissue: Zhenshan97 flag leaf, score: 65.3	N	N	N	N
vg0729640266	A -> G	LOC_Os07g49490.1	upstream_gene_variant ; 792.0bp to feature; MODIFIER	silent_mutation	Average:56.639; most accessible tissue: Zhenshan97 flag leaf, score: 65.3	N	N	N	N
vg0729640266	A -> G	LOC_Os07g49480.2	upstream_gene_variant ; 1903.0bp to feature; MODIFIER	silent_mutation	Average:56.639; most accessible tissue: Zhenshan97 flag leaf, score: 65.3	N	N	N	N
vg0729640266	A -> G	LOC_Os07g49500.1	downstream_gene_variant ; 3931.0bp to feature; MODIFIER	silent_mutation	Average:56.639; most accessible tissue: Zhenshan97 flag leaf, score: 65.3	N	N	N	N
vg0729640266	A -> G	LOC_Os07g49480-LOC_Os07g49490	intergenic_region ; MODIFIER	silent_mutation	Average:56.639; most accessible tissue: Zhenshan97 flag leaf, score: 65.3	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0729640266	NA	6.66E-15	mr1013	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729640266	NA	4.83E-14	mr1034	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729640266	NA	1.38E-08	mr1045	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729640266	NA	7.17E-24	mr1115	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729640266	NA	1.37E-07	mr1252	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729640266	NA	3.43E-24	mr1611	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729640266	NA	1.81E-21	mr1689	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729640266	NA	5.74E-07	mr1763	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729640266	NA	6.66E-06	mr1837	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729640266	NA	2.10E-24	mr1862	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729640266	NA	1.66E-25	mr1920	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729640266	4.39E-06	NA	mr1940	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729640266	NA	1.12E-07	mr1946	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729640266	NA	1.16E-12	mr1248_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729640266	NA	4.14E-07	mr1250_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729640266	NA	5.23E-09	mr1454_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729640266	NA	7.78E-08	mr1578_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729640266	NA	3.63E-23	mr1611_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729640266	NA	1.19E-06	mr1671_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729640266	NA	1.86E-08	mr1952_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251