Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0729605765:

Variant ID: vg0729605765 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 29605765
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCAAGGGAGAAAGCAAAGGGGTAGAAAATGCGAAGGGGAAGCTTTATTTATAGACAAGACGGCACGATAGCCTAAAGACAAGAAGTGTCTGCTGCAGACA[C/T]
ACAACAAAAGGAAATTAAAAGTGGGGATAATCATGGAGTGCCCGGGCCCCCGAGGTCGGCGCCGCTGACCACGTCGTCCCAGTCCTCGCCATCGGCGTCG

Reverse complement sequence

CGACGCCGATGGCGAGGACTGGGACGACGTGGTCAGCGGCGCCGACCTCGGGGGCCCGGGCACTCCATGATTATCCCCACTTTTAATTTCCTTTTGTTGT[G/A]
TGTCTGCAGCAGACACTTCTTGTCTTTAGGCTATCGTGCCGTCTTGTCTATAAATAAAGCTTCCCCTTCGCATTTTCTACCCCTTTGCTTTCTCCCTTGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.50% 7.40% 0.08% 0.00% NA
All Indica  2759 99.20% 0.80% 0.00% 0.00% NA
All Japonica  1512 78.60% 21.20% 0.20% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 98.80% 1.20% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 98.50% 1.50% 0.00% 0.00% NA
Temperate Japonica  767 94.10% 5.90% 0.00% 0.00% NA
Tropical Japonica  504 50.40% 49.20% 0.40% 0.00% NA
Japonica Intermediate  241 88.40% 11.20% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 88.90% 10.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0729605765 C -> T LOC_Os07g49430.1 downstream_gene_variant ; 870.0bp to feature; MODIFIER silent_mutation Average:63.732; most accessible tissue: Zhenshan97 flag leaf, score: 82.874 N N N N
vg0729605765 C -> T LOC_Os07g49440.1 downstream_gene_variant ; 31.0bp to feature; MODIFIER silent_mutation Average:63.732; most accessible tissue: Zhenshan97 flag leaf, score: 82.874 N N N N
vg0729605765 C -> T LOC_Os07g49430-LOC_Os07g49440 intergenic_region ; MODIFIER silent_mutation Average:63.732; most accessible tissue: Zhenshan97 flag leaf, score: 82.874 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0729605765 NA 2.48E-06 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729605765 NA 8.78E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729605765 2.33E-06 NA mr1169 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729605765 NA 9.80E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729605765 NA 5.43E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729605765 NA 6.38E-11 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729605765 NA 5.83E-06 mr1683 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729605765 NA 4.50E-06 mr1740 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729605765 NA 4.52E-06 mr1773 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729605765 NA 8.45E-09 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251