Variant ID: vg0729605765 (JBrowse) | Variation Type: SNP |
Chromosome: chr07 | Position: 29605765 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TCAAGGGAGAAAGCAAAGGGGTAGAAAATGCGAAGGGGAAGCTTTATTTATAGACAAGACGGCACGATAGCCTAAAGACAAGAAGTGTCTGCTGCAGACA[C/T]
ACAACAAAAGGAAATTAAAAGTGGGGATAATCATGGAGTGCCCGGGCCCCCGAGGTCGGCGCCGCTGACCACGTCGTCCCAGTCCTCGCCATCGGCGTCG
CGACGCCGATGGCGAGGACTGGGACGACGTGGTCAGCGGCGCCGACCTCGGGGGCCCGGGCACTCCATGATTATCCCCACTTTTAATTTCCTTTTGTTGT[G/A]
TGTCTGCAGCAGACACTTCTTGTCTTTAGGCTATCGTGCCGTCTTGTCTATAAATAAAGCTTCCCCTTCGCATTTTCTACCCCTTTGCTTTCTCCCTTGA
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 92.50% | 7.40% | 0.08% | 0.00% | NA |
All Indica | 2759 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 78.60% | 21.20% | 0.20% | 0.00% | NA |
Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Indica I | 595 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 94.10% | 5.90% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 50.40% | 49.20% | 0.40% | 0.00% | NA |
Japonica Intermediate | 241 | 88.40% | 11.20% | 0.41% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 88.90% | 10.00% | 1.11% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0729605765 | C -> T | LOC_Os07g49430.1 | downstream_gene_variant ; 870.0bp to feature; MODIFIER | silent_mutation | Average:63.732; most accessible tissue: Zhenshan97 flag leaf, score: 82.874 | N | N | N | N |
vg0729605765 | C -> T | LOC_Os07g49440.1 | downstream_gene_variant ; 31.0bp to feature; MODIFIER | silent_mutation | Average:63.732; most accessible tissue: Zhenshan97 flag leaf, score: 82.874 | N | N | N | N |
vg0729605765 | C -> T | LOC_Os07g49430-LOC_Os07g49440 | intergenic_region ; MODIFIER | silent_mutation | Average:63.732; most accessible tissue: Zhenshan97 flag leaf, score: 82.874 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0729605765 | NA | 2.48E-06 | mr1045 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0729605765 | NA | 8.78E-06 | mr1164 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0729605765 | 2.33E-06 | NA | mr1169 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0729605765 | NA | 9.80E-06 | mr1418 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0729605765 | NA | 5.43E-06 | mr1596 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0729605765 | NA | 6.38E-11 | mr1683 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0729605765 | NA | 5.83E-06 | mr1683 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0729605765 | NA | 4.50E-06 | mr1740 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0729605765 | NA | 4.52E-06 | mr1773 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0729605765 | NA | 8.45E-09 | mr1851_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |