\
| Variant ID: vg0729558870 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 29558870 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTAAATCAAACTTTGGGAATATAAATCATGAATAACTCTAAAGTTAGTTGTTGAGTTTGAAAATGTAAAAGTTATATGAATAGATTTGTCTTGAAAAATA[C/T]
TTTCATAAAAGTATACATATATCACTTTTTAATAAATATTTTTATAGAAACAAGAAGTCAAAGTTGTGTTTTGGAGACCGTGTCGCTGTCCAAAACGACT
AGTCGTTTTGGACAGCGACACGGTCTCCAAAACACAACTTTGACTTCTTGTTTCTATAAAAATATTTATTAAAAAGTGATATATGTATACTTTTATGAAA[G/A]
TATTTTTCAAGACAAATCTATTCATATAACTTTTACATTTTCAAACTCAACAACTAACTTTAGAGTTATTCATGATTTATATTCCCAAAGTTTGATTTAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.00% | 49.80% | 0.06% | 0.21% | NA |
| All Indica | 2759 | 28.40% | 71.20% | 0.04% | 0.33% | NA |
| All Japonica | 1512 | 87.10% | 12.80% | 0.13% | 0.00% | NA |
| Aus | 269 | 42.00% | 58.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 5.50% | 94.10% | 0.17% | 0.17% | NA |
| Indica II | 465 | 13.10% | 86.50% | 0.00% | 0.43% | NA |
| Indica III | 913 | 47.30% | 52.20% | 0.00% | 0.44% | NA |
| Indica Intermediate | 786 | 32.80% | 66.90% | 0.00% | 0.25% | NA |
| Temperate Japonica | 767 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 78.20% | 21.60% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 67.60% | 32.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 60.00% | 38.90% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0729558870 | C -> DEL | N | N | silent_mutation | Average:30.734; most accessible tissue: Minghui63 root, score: 43.505 | N | N | N | N |
| vg0729558870 | C -> T | LOC_Os07g49350.1 | upstream_gene_variant ; 831.0bp to feature; MODIFIER | silent_mutation | Average:30.734; most accessible tissue: Minghui63 root, score: 43.505 | N | N | N | N |
| vg0729558870 | C -> T | LOC_Os07g49340.1 | downstream_gene_variant ; 3228.0bp to feature; MODIFIER | silent_mutation | Average:30.734; most accessible tissue: Minghui63 root, score: 43.505 | N | N | N | N |
| vg0729558870 | C -> T | LOC_Os07g49360.1 | downstream_gene_variant ; 2310.0bp to feature; MODIFIER | silent_mutation | Average:30.734; most accessible tissue: Minghui63 root, score: 43.505 | N | N | N | N |
| vg0729558870 | C -> T | LOC_Os07g49350-LOC_Os07g49360 | intergenic_region ; MODIFIER | silent_mutation | Average:30.734; most accessible tissue: Minghui63 root, score: 43.505 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0729558870 | NA | 5.67E-14 | mr1352 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729558870 | NA | 1.36E-09 | mr1352 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729558870 | NA | 4.04E-09 | mr1063_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729558870 | NA | 2.80E-06 | mr1115_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729558870 | NA | 6.69E-08 | mr1215_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729558870 | NA | 2.48E-20 | mr1218_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729558870 | NA | 1.33E-09 | mr1352_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729558870 | NA | 3.75E-06 | mr1533_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729558870 | NA | 2.76E-11 | mr1850_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729558870 | NA | 3.83E-06 | mr1980_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |