\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0729558870:

Variant ID: vg0729558870 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 29558870
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTAAATCAAACTTTGGGAATATAAATCATGAATAACTCTAAAGTTAGTTGTTGAGTTTGAAAATGTAAAAGTTATATGAATAGATTTGTCTTGAAAAATA[C/T]
TTTCATAAAAGTATACATATATCACTTTTTAATAAATATTTTTATAGAAACAAGAAGTCAAAGTTGTGTTTTGGAGACCGTGTCGCTGTCCAAAACGACT

Reverse complement sequence

AGTCGTTTTGGACAGCGACACGGTCTCCAAAACACAACTTTGACTTCTTGTTTCTATAAAAATATTTATTAAAAAGTGATATATGTATACTTTTATGAAA[G/A]
TATTTTTCAAGACAAATCTATTCATATAACTTTTACATTTTCAAACTCAACAACTAACTTTAGAGTTATTCATGATTTATATTCCCAAAGTTTGATTTAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.00% 49.80% 0.06% 0.21% NA
All Indica  2759 28.40% 71.20% 0.04% 0.33% NA
All Japonica  1512 87.10% 12.80% 0.13% 0.00% NA
Aus  269 42.00% 58.00% 0.00% 0.00% NA
Indica I  595 5.50% 94.10% 0.17% 0.17% NA
Indica II  465 13.10% 86.50% 0.00% 0.43% NA
Indica III  913 47.30% 52.20% 0.00% 0.44% NA
Indica Intermediate  786 32.80% 66.90% 0.00% 0.25% NA
Temperate Japonica  767 99.10% 0.90% 0.00% 0.00% NA
Tropical Japonica  504 78.20% 21.60% 0.20% 0.00% NA
Japonica Intermediate  241 67.60% 32.00% 0.41% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 60.00% 38.90% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0729558870 C -> DEL N N silent_mutation Average:30.734; most accessible tissue: Minghui63 root, score: 43.505 N N N N
vg0729558870 C -> T LOC_Os07g49350.1 upstream_gene_variant ; 831.0bp to feature; MODIFIER silent_mutation Average:30.734; most accessible tissue: Minghui63 root, score: 43.505 N N N N
vg0729558870 C -> T LOC_Os07g49340.1 downstream_gene_variant ; 3228.0bp to feature; MODIFIER silent_mutation Average:30.734; most accessible tissue: Minghui63 root, score: 43.505 N N N N
vg0729558870 C -> T LOC_Os07g49360.1 downstream_gene_variant ; 2310.0bp to feature; MODIFIER silent_mutation Average:30.734; most accessible tissue: Minghui63 root, score: 43.505 N N N N
vg0729558870 C -> T LOC_Os07g49350-LOC_Os07g49360 intergenic_region ; MODIFIER silent_mutation Average:30.734; most accessible tissue: Minghui63 root, score: 43.505 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0729558870 NA 5.67E-14 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729558870 NA 1.36E-09 mr1352 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729558870 NA 4.04E-09 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729558870 NA 2.80E-06 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729558870 NA 6.69E-08 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729558870 NA 2.48E-20 mr1218_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729558870 NA 1.33E-09 mr1352_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729558870 NA 3.75E-06 mr1533_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729558870 NA 2.76E-11 mr1850_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729558870 NA 3.83E-06 mr1980_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251