Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0729553842:

Variant ID: vg0729553842 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 29553842
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AACTTTTGTGGTCAAGAATGGTTACTTAATTTATAATGCACTTTTCTATATATTTCATCATACAAAGCACATGACAGGGTGGTTAAAGCCGCGCGAATGC[A/G]
CTACTTCATTAGCTAGTTTCTTTGTACAACCTTCAACTTTAAATTTATCTTCGTCACATGTCATGCAGCAAATTATGGAGAAGATGATATTGTATTTGAC

Reverse complement sequence

GTCAAATACAATATCATCTTCTCCATAATTTGCTGCATGACATGTGACGAAGATAAATTTAAAGTTGAAGGTTGTACAAAGAAACTAGCTAATGAAGTAG[T/C]
GCATTCGCGCGGCTTTAACCACCCTGTCATGTGCTTTGTATGATGAAATATATAGAAAAGTGCATTATAAATTAAGTAACCATTCTTGACCACAAAAGTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.50%	2.60%	0.89%	0.00%	NA
All Indica	2759	100.00%	0.00%	0.04%	0.00%	NA
All Japonica	1512	89.60%	7.90%	2.51%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.00%	0.22%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	100.00%	0.00%	0.00%	0.00%	NA
Temperate Japonica	767	80.20%	15.00%	4.82%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	1.20%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	92.20%	4.40%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0729553842	A -> G	LOC_Os07g49330.1	upstream_gene_variant ; 4861.0bp to feature; MODIFIER	silent_mutation	Average:17.138; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg0729553842	A -> G	LOC_Os07g49330.3	upstream_gene_variant ; 4864.0bp to feature; MODIFIER	silent_mutation	Average:17.138; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg0729553842	A -> G	LOC_Os07g49350.1	downstream_gene_variant ; 2176.0bp to feature; MODIFIER	silent_mutation	Average:17.138; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg0729553842	A -> G	LOC_Os07g49340.1	intron_variant ; MODIFIER	silent_mutation	Average:17.138; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0729553842	NA	5.63E-08	mr1354	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729553842	NA	1.94E-07	mr1902	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729553842	NA	9.32E-09	mr1354_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729553842	NA	1.17E-06	mr1576_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729553842	7.92E-07	9.44E-06	mr1666_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729553842	NA	5.28E-06	mr1768_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729553842	NA	1.28E-06	mr1829_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729553842	NA	9.34E-08	mr1902_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251