Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0729550923:

Variant ID: vg0729550923 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 29550923
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCTTTTCTTATTAATAACTCTTTTGCTATATTAGTTTTTTTCTTCAATGACAATATATTTAATGCTATAAACTACTCCCTCCGTATTTTAATGTATGACG[C/T]
CGTTGACTTTTCGATAAATATTTGACCATTTATTTTATTCAAAATTTTTGTGCAAATATGAAAATATTTATGTCATGATTAAAGAATATTTGATGACGAA

Reverse complement sequence

TTCGTCATCAAATATTCTTTAATCATGACATAAATATTTTCATATTTGCACAAAAATTTTGAATAAAATAAATGGTCAAATATTTATCGAAAAGTCAACG[G/A]
CGTCATACATTAAAATACGGAGGGAGTAGTTTATAGCATTAAATATATTGTCATTGAAGAAAAAAACTAATATAGCAAAAGAGTTATTAATAAGAAAAGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.80%	21.20%	0.00%	0.00%	NA
All Indica	2759	99.10%	0.90%	0.00%	0.00%	NA
All Japonica	1512	39.60%	60.40%	0.00%	0.00%	NA
Aus	269	89.20%	10.80%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	98.30%	1.70%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	98.10%	1.90%	0.00%	0.00%	NA
Temperate Japonica	767	6.90%	93.10%	0.00%	0.00%	NA
Tropical Japonica	504	85.70%	14.30%	0.00%	0.00%	NA
Japonica Intermediate	241	47.30%	52.70%	0.00%	0.00%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	70.00%	30.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0729550923	C -> T	LOC_Os07g49330.1	upstream_gene_variant ; 1942.0bp to feature; MODIFIER	silent_mutation	Average:39.916; most accessible tissue: Zhenshan97 flag leaf, score: 54.545	N	N	N	N
vg0729550923	C -> T	LOC_Os07g49340.1	upstream_gene_variant ; 1987.0bp to feature; MODIFIER	silent_mutation	Average:39.916; most accessible tissue: Zhenshan97 flag leaf, score: 54.545	N	N	N	N
vg0729550923	C -> T	LOC_Os07g49330.3	upstream_gene_variant ; 1945.0bp to feature; MODIFIER	silent_mutation	Average:39.916; most accessible tissue: Zhenshan97 flag leaf, score: 54.545	N	N	N	N
vg0729550923	C -> T	LOC_Os07g49330-LOC_Os07g49340	intergenic_region ; MODIFIER	silent_mutation	Average:39.916; most accessible tissue: Zhenshan97 flag leaf, score: 54.545	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0729550923	NA	3.82E-14	mr1013	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729550923	NA	4.13E-13	mr1034	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729550923	NA	9.50E-09	mr1045	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729550923	NA	3.54E-25	mr1115	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729550923	NA	7.68E-06	mr1124	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729550923	NA	1.16E-08	mr1549	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729550923	NA	1.20E-25	mr1611	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729550923	NA	8.08E-07	mr1629	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729550923	NA	1.41E-07	mr1671	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729550923	NA	1.11E-23	mr1689	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729550923	NA	7.07E-06	mr1689	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729550923	NA	3.01E-07	mr1763	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729550923	NA	1.72E-06	mr1837	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729550923	NA	2.00E-24	mr1862	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729550923	NA	1.53E-25	mr1920	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729550923	NA	9.17E-08	mr1946	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729550923	NA	4.48E-06	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729550923	NA	1.28E-07	mr1002_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729550923	NA	1.97E-06	mr1250_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729550923	NA	1.63E-08	mr1454_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729550923	NA	4.03E-08	mr1578_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729550923	NA	1.78E-22	mr1611_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729550923	NA	4.46E-09	mr1952_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251