\
| Variant ID: vg0729550923 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 29550923 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TCTTTTCTTATTAATAACTCTTTTGCTATATTAGTTTTTTTCTTCAATGACAATATATTTAATGCTATAAACTACTCCCTCCGTATTTTAATGTATGACG[C/T]
CGTTGACTTTTCGATAAATATTTGACCATTTATTTTATTCAAAATTTTTGTGCAAATATGAAAATATTTATGTCATGATTAAAGAATATTTGATGACGAA
TTCGTCATCAAATATTCTTTAATCATGACATAAATATTTTCATATTTGCACAAAAATTTTGAATAAAATAAATGGTCAAATATTTATCGAAAAGTCAACG[G/A]
CGTCATACATTAAAATACGGAGGGAGTAGTTTATAGCATTAAATATATTGTCATTGAAGAAAAAAACTAATATAGCAAAAGAGTTATTAATAAGAAAAGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.80% | 21.20% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 39.60% | 60.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 89.20% | 10.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 6.90% | 93.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 85.70% | 14.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 47.30% | 52.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 70.00% | 30.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0729550923 | C -> T | LOC_Os07g49330.1 | upstream_gene_variant ; 1942.0bp to feature; MODIFIER | silent_mutation | Average:39.916; most accessible tissue: Zhenshan97 flag leaf, score: 54.545 | N | N | N | N |
| vg0729550923 | C -> T | LOC_Os07g49340.1 | upstream_gene_variant ; 1987.0bp to feature; MODIFIER | silent_mutation | Average:39.916; most accessible tissue: Zhenshan97 flag leaf, score: 54.545 | N | N | N | N |
| vg0729550923 | C -> T | LOC_Os07g49330.3 | upstream_gene_variant ; 1945.0bp to feature; MODIFIER | silent_mutation | Average:39.916; most accessible tissue: Zhenshan97 flag leaf, score: 54.545 | N | N | N | N |
| vg0729550923 | C -> T | LOC_Os07g49330-LOC_Os07g49340 | intergenic_region ; MODIFIER | silent_mutation | Average:39.916; most accessible tissue: Zhenshan97 flag leaf, score: 54.545 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0729550923 | NA | 3.82E-14 | mr1013 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729550923 | NA | 4.13E-13 | mr1034 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729550923 | NA | 9.50E-09 | mr1045 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729550923 | NA | 3.54E-25 | mr1115 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729550923 | NA | 7.68E-06 | mr1124 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729550923 | NA | 1.16E-08 | mr1549 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729550923 | NA | 1.20E-25 | mr1611 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729550923 | NA | 8.08E-07 | mr1629 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729550923 | NA | 1.41E-07 | mr1671 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729550923 | NA | 1.11E-23 | mr1689 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729550923 | NA | 7.07E-06 | mr1689 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729550923 | NA | 3.01E-07 | mr1763 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729550923 | NA | 1.72E-06 | mr1837 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729550923 | NA | 2.00E-24 | mr1862 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729550923 | NA | 1.53E-25 | mr1920 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729550923 | NA | 9.17E-08 | mr1946 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729550923 | NA | 4.48E-06 | mr1977 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729550923 | NA | 1.28E-07 | mr1002_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729550923 | NA | 1.97E-06 | mr1250_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729550923 | NA | 1.63E-08 | mr1454_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729550923 | NA | 4.03E-08 | mr1578_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729550923 | NA | 1.78E-22 | mr1611_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729550923 | NA | 4.46E-09 | mr1952_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |