\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0729518472:

Variant ID: vg0729518472 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 29518472
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCGACTACTCCACTGGAGTATTCCGTTGGGCTTCCTGGGATACCAAACAATAAATGGGCCACAGAGATGTTGCTGTTTTGCTCGTCTCATGTGAGATATG[T/C]
AAACGACTAGGCCTTCACATATTCATCCGGAATAAGCGTACAAACTACGAATAAAAATTAAAAATATATGTTTTTTCCTAACTTTTTATAATTATATACG

Reverse complement sequence

CGTATATAATTATAAAAAGTTAGGAAAAAACATATATTTTTAATTTTTATTCGTAGTTTGTACGCTTATTCCGGATGAATATGTGAAGGCCTAGTCGTTT[A/G]
CATATCTCACATGAGACGAGCAAAACAGCAACATCTCTGTGGCCCATTTATTGTTTGGTATCCCAGGAAGCCCAACGGAATACTCCAGTGGAGTAGTCGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.20% 47.60% 0.15% 0.00% NA
All Indica  2759 75.20% 24.60% 0.18% 0.00% NA
All Japonica  1512 12.80% 87.20% 0.00% 0.00% NA
Aus  269 58.40% 41.30% 0.37% 0.00% NA
Indica I  595 94.30% 5.50% 0.17% 0.00% NA
Indica II  465 87.70% 12.00% 0.22% 0.00% NA
Indica III  913 58.20% 41.60% 0.22% 0.00% NA
Indica Intermediate  786 73.20% 26.70% 0.13% 0.00% NA
Temperate Japonica  767 0.80% 99.20% 0.00% 0.00% NA
Tropical Japonica  504 21.60% 78.40% 0.00% 0.00% NA
Japonica Intermediate  241 32.40% 67.60% 0.00% 0.00% NA
VI/Aromatic  96 7.30% 92.70% 0.00% 0.00% NA
Intermediate  90 41.10% 57.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0729518472 T -> C LOC_Os07g49280.1 upstream_gene_variant ; 2097.0bp to feature; MODIFIER silent_mutation Average:89.548; most accessible tissue: Callus, score: 97.396 N N N N
vg0729518472 T -> C LOC_Os07g49300.1 upstream_gene_variant ; 3970.0bp to feature; MODIFIER silent_mutation Average:89.548; most accessible tissue: Callus, score: 97.396 N N N N
vg0729518472 T -> C LOC_Os07g49290.1 downstream_gene_variant ; 979.0bp to feature; MODIFIER silent_mutation Average:89.548; most accessible tissue: Callus, score: 97.396 N N N N
vg0729518472 T -> C LOC_Os07g49280-LOC_Os07g49290 intergenic_region ; MODIFIER silent_mutation Average:89.548; most accessible tissue: Callus, score: 97.396 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0729518472 T C -0.01 0.06 0.03 -0.01 0.03 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0729518472 NA 4.37E-10 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729518472 NA 6.60E-07 mr1850 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729518472 1.41E-06 1.41E-06 mr1929 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729518472 NA 2.77E-09 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729518472 NA 5.45E-08 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729518472 NA 7.57E-06 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729518472 NA 1.67E-21 mr1218_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729518472 NA 5.26E-08 mr1218_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729518472 NA 1.89E-06 mr1260_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729518472 NA 9.22E-06 mr1422_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729518472 NA 2.03E-12 mr1850_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251