\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0729495328:

Variant ID: vg0729495328 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 29495328
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.73, T: 0.27, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


AATGTGCTACCTAAATTAACTACAAAATTTAGATAGGGTTGCTAAAAAGAATTTCTCTAAGAAAGTCATTTGTTTCTTCCGTTTCTTCTTGAGATTGTAC[C/T]
TCCTATCTAACAAATTGATGTTAACCAAGTCCAGCAGCAACGTGCGGGGCATCCTCTAGTAGTTATTGATGTCATGGCCATATATTGTTGACATGGCAGA

Reverse complement sequence

TCTGCCATGTCAACAATATATGGCCATGACATCAATAACTACTAGAGGATGCCCCGCACGTTGCTGCTGGACTTGGTTAACATCAATTTGTTAGATAGGA[G/A]
GTACAATCTCAAGAAGAAACGGAAGAAACAAATGACTTTCTTAGAGAAATTCTTTTTAGCAACCCTATCTAAATTTTGTAGTTAATTTAGGTAGCACATT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.70% 38.70% 0.57% 0.00% NA
All Indica  2759 78.20% 21.60% 0.25% 0.00% NA
All Japonica  1512 22.10% 76.90% 1.06% 0.00% NA
Aus  269 88.80% 11.20% 0.00% 0.00% NA
Indica I  595 94.30% 5.50% 0.17% 0.00% NA
Indica II  465 88.00% 11.80% 0.22% 0.00% NA
Indica III  913 64.10% 35.50% 0.44% 0.00% NA
Indica Intermediate  786 76.60% 23.30% 0.13% 0.00% NA
Temperate Japonica  767 1.20% 98.80% 0.00% 0.00% NA
Tropical Japonica  504 47.60% 50.20% 2.18% 0.00% NA
Japonica Intermediate  241 35.30% 62.70% 2.07% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 53.30% 42.20% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0729495328 C -> T LOC_Os07g49260.1 upstream_gene_variant ; 586.0bp to feature; MODIFIER silent_mutation Average:46.279; most accessible tissue: Callus, score: 63.424 N N N N
vg0729495328 C -> T LOC_Os07g49250.1 downstream_gene_variant ; 3155.0bp to feature; MODIFIER silent_mutation Average:46.279; most accessible tissue: Callus, score: 63.424 N N N N
vg0729495328 C -> T LOC_Os07g49250-LOC_Os07g49260 intergenic_region ; MODIFIER silent_mutation Average:46.279; most accessible tissue: Callus, score: 63.424 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0729495328 NA 9.11E-09 mr1248 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729495328 NA 6.42E-06 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729495328 NA 1.99E-08 mr1800 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729495328 NA 9.95E-08 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729495328 NA 8.54E-06 mr1228_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729495328 NA 2.42E-07 mr1308_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729495328 NA 7.62E-06 mr1415_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729495328 NA 5.88E-06 mr1554_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729495328 NA 1.25E-06 mr1557_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729495328 NA 3.01E-07 mr1558_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729495328 1.23E-06 1.23E-06 mr1562_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729495328 NA 5.43E-07 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729495328 NA 3.68E-07 mr1696_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729495328 NA 1.20E-06 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729495328 NA 1.17E-11 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729495328 NA 7.66E-06 mr1944_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729495328 NA 3.30E-18 mr1980_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251